We narrowed to 26,611 results for: RON
-
Plasmid#119898PurposeMouse GFR alpha 1 In situ hybridization probeDepositorInsertGDNF family receptor alpha-1 precursor (Gfra1 Mouse)
UseIn situ hybridization probeAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0202
Plasmid#185626PurposeMoClo Level 1, position 5 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-AtAFB2-mTagBFP2
Plasmid#179889PurposeExpresses AtAFB2 (auxin-inducible degron system) fused to mTagBFP2 (lentiviral plasmid)DepositorInsertAtAFB2 (AFB2 Synthetic, Mustard Weed)
UseLentiviralTagsmTagBFP2ExpressionBacterial and MammalianPromoterEF1Available SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJ207 Delta-cpc-KanR
Plasmid#51468PurposeDeletes the cpc operon in Synechocystis and confers kanamycin resistanceDepositorInsertReplacing the cpc operon with kanamycin resistance
UseSynthetic BiologyPromoterSynechocystis endogenous cpc-operon promoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal TDP43 G294A
Plasmid#27459DepositorAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pSB165 - pL1R3_pMAS::rLUC-I::tMAS
Plasmid#123198Purposebinary plant vector for transient expression of a Renilla luciferase (rLUC, with intron)DepositorInsertpMAS::rLUC-I::tMAS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGlomyc-Frat1
Plasmid#124499PurposeExpresses myc-tagged mouse FRAT1 in mammalian cells (N-terminal tag)DepositorAvailable SinceMay 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGlomyc-Frat2
Plasmid#124500PurposeExpresses myc-tagged mouse FRAT2 in mammalian cells (N-terminal tag)DepositorAvailable SinceMay 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNB785
Plasmid#60164PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by SIC1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterSIC1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNB787
Plasmid#60152PurposeFirefly luciferase (Promega) and yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by LEU1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterLEU1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNB789
Plasmid#60166PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by RNR1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterRNR1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-opEas1
Plasmid#240701PurposeRSF1010 origin of replication plasmid containing Eas1 recombitron with extended a1 a2 regions in the ncRNA targeting lacZ locus in Klebsiella pneumoniae ATCC 10031 expressed by Pm promoterDepositorInsertEas1 RT, Eas1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECBRR1-Kva1
Plasmid#240703Purposeinverted BRR1 origin of replication plasmid containing Kva1 recombitron with a donor in the ncRNA to target phzM locus in Pseudomonas aeruginosa PAO1 expressed by Pm promoterDepositorInsertKva1 RT,Kva1 ncRNA, PaRecT and PaSSB
ExpressionBacterialMutationInverted BRR1 origin of replicationAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-3
Plasmid#237892PurposeCre-KO AAV vector#3 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only