We narrowed to 5,873 results for: org
-
Plasmid#34609DepositorInsertKLF4 (KLF4 Human)
UseRetroviralTagsMyc epitope tag and estrogen receptor fusionExpressionMammalianPromoterLTRAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1-Eps8 ∆bund
Plasmid#74889Purposemammalian expression of the bundling activity mutant Eps8 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVAX1-BMP2/7 -
Plasmid#137912PurposeConstitutive mammalian co-expression vector for human bone morphogenetic protein 2 and 7 cDNAs (2 transcriptional units, divergent)DepositorAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS
Plasmid#98566PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationIn a synthetic operon downstream of UBP1 and Remo…PromoterSame as UBP1 (operon) and Tet promoter (aTc induc…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF716
Plasmid#101481PurposeDonor Vector containing ZNF716 transcription factor, part of the Human TFome CollectionDepositorInsertZNF716 (ZNF716 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin.PPT.CMV‐GFP‐Eps8 WT
Plasmid#74922PurposeLentiviral plasmid expressing Eps8 fused to GFPDepositorAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF808
Plasmid#101470PurposeDonor Vector containing ZNF808 transcription factor, part of the Human TFome CollectionDepositorInsertZNF808 (ZNF808 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF442
Plasmid#101455PurposeDonor Vector containing ZNF442 transcription factor, part of the Human TFome CollectionDepositorInsertZNF442 (ZNF442 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-4
Plasmid#133404Purposehuman ETV6 gRNA-3 and 4 is a pair of gRNAs. Four ETV6 gRNA plasmids used the same backbone(Addgene plasmid#41824). ETV6 gRNA-4 target the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE MD-deltaN-ER
Plasmid#13496DepositorInsertMyoD1-Estrogen Receptor Fusion Protein (Myod1 Human, Mouse)
UseRetroviralExpressionMammalianMutationMyoD (containing a deletion in aa3-56) was fused …Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pKlab264-pcDNA3-BRCA1(1314-end)-M1783T-V5-3xFLAG
Plasmid#249017PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the M1783T mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationM1783TPromoterCMV PromoterAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab211-pcDNA3-BRCA1(1314-end)-L1705R-V5-3xFLAG
Plasmid#249015PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the L1705R mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationL1705RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab240-pcDNA3-BRCA1(1314-end)-Y1845D-V5-3xFLAG
Plasmid#249016PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the Y1845D mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab981-pcDNA3-BRCA1(1314-end)-V1736A-V5-3xFLAG
Plasmid#249018PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the V1736A mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationV1736APromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab224-pcDNA3-BRCA1(1314-end)-R1699W-V5-3xFLAG
Plasmid#249019PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domain that contains the R1699W mutationDepositorInsertBRCA1(1314aa-end) (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationR1699WPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only