We narrowed to 15,978 results for: grna
-
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
330-BFP-hCYP3A4-enhancer-R-sgRNA
Plasmid#176841PurposeTargeting human CYP3A4 proximal enhancer right boundary. sgRNA expressing cells could be FACS sorted by BFP expression.DepositorInsertHuman CYP3A4 proximal enhancer right boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
330-cherry-hCYP3A4-enhancer-L-sgRNA
Plasmid#176840PurposeTargeting human CYP3A4 proximal enhancer left boundary. sgRNA expressing cells could be FACS sorted by cherry expression.DepositorInsertHuman CYP3A4 proximal enhancer left boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro sgRNA KGA Stop1
Plasmid#110405PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistanceDepositorAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2ABFP-W
Plasmid#163170PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W
Plasmid#163172PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI733 pRPR1(TetO)-RPC31-sgRNA
Plasmid#164913PurposeFor yeast genomic integration of sgRNA against RPC31DepositorInsertpRPR1(TetO)-RPC31-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI732 pRPR1(TetO)-HTS1-sgRNA
Plasmid#164912PurposeFor yeast genomic integration of sgRNA against HTS1DepositorInsertpRPR1(TetO)-HTS1-sgRNA
UseCRISPRExpressionYeastPromoterRPR1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-5U6-sgRNAs-hsyn-EGFP
Plasmid#112213PurposeTargeted DNA methylationDepositorInsertsgRNAs
UseAAVAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
ExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_gcrA3
Plasmid#133343Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets gcrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZDonor-U6-myogenin stop codon gRNA
Plasmid#69549PurposeExpresses guide RNA targeting near the stop codon of myogenin in the mouse genome.DepositorInsertMyogenin C terminus-targeting guide RNA
UseCRISPRAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330 Gatad2a sgRNA (for flox targeting)
Plasmid#110815PurposeUsed with pNTK Gatad2a flox allele targeting construct in mouse cellsDepositorInsertmGataD2a (Gatad2a Mouse)
ExpressionMammalianAvailable SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP
Plasmid#114730PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M7
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-IRES-CFP
Plasmid#114728PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146109)
Plasmid#80242Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only