We narrowed to 3,749 results for: YFP
-
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti/TO/EYFP-P2A-IDH1(HA)
Plasmid#122482PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HADepositorInsertisocitrate dehydrogenase 1 (IDH1 Human)
UseLentiviralTagsHA and P2AExpressionMammalianPromoterCMV/TOAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJM502 ZF1x6-C EYFP in TUPV1
Plasmid#161527PurposeInducible expression of EYFP under the ZF1x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF1x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CUP Ent2 YFP p316
Plasmid#15593DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGM-ENO2-mCherry-YFP
Plasmid#180570PurposeDual fluorescent reporter for 5' UTR activity in yeast mCherry/YFPDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGM-ENO2-YFP-mCherry
Plasmid#180569PurposeDual fluorescent reporter for 5' UTR activity in yeast YFP/mCherryDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal-RNQ1-YFP
Plasmid#18685DepositorAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJM587 ZF10x6-C EYFP in TUPV2
Plasmid#161530PurposeInducible expression of EYFP under the ZF10x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF10x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
N-TAP A2A-YFP pcDNA3
Plasmid#67852Purposemammalian expression of A2A receptor with N terminal TAP tag and C terminal YFP fusionDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CUP Pan1 YFP p316
Plasmid#15592DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pASH3 [pmyo-3::BeCNG1-YFP]
Plasmid#168167PurposeExpression of BeCNG1-YFP in BWMs of C. elegansDepositorInsertBeCNG1-YFP
TagsYFPExpressionWormAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-ABI2-YFPn-1
Plasmid#102383Purposesplit YFP. Plant expression of ABI2-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
PacrAB-rfp + PmutS-yfp
Plasmid#121442Purposeplasmid reporting the expression from the acrAB and mutS promotersDepositorInsertsPmutS-yfp
PacrAB-rfp
UseSynthetic Biology; Pbb vectorExpressionBacterialPromoterPacrAB and PmutSAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSF-p15A-tac- YFP
Plasmid#186570Purposep15A ori, lacI, Ptac promoter, AmpR. Kringle YFP (Yellow Fluorescence Protein) expressionDepositorInsertYFP
ExpressionBacterialPromotertac promoterAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger3-TS-EYFP
Plasmid#127241PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-Lyk5-YFPn-1
Plasmid#102389Purposesplit YFP. Plant expression of Lyk5-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEIAV-TLoop-Chr2-YFP
Plasmid#80160PurposeExpression in mammalian cellsDepositorInsertChr2
UseLentiviralTagsYFPMutationH134RPromoterCMV TetOx7Available SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJM467 TRE3GV EYFP in TU3
Plasmid#139255PurposeTRE3GV promoter and EYFP in TUPV3DepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CBL2-YFPc-1
Plasmid#102394Purposesplit YFP. Plant expression of CBL2-YFPc-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET15b/EYFP-GgVcl 1-851
Plasmid#46264DepositorInsertVcl 1-851 (VCL Chicken)
TagsEYFP and HisExpressionBacterialMutationaa 1-851 (aka Vh) head domainPromoterT7Available SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
CUP Rnq1 YFP p316
Plasmid#15596DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-H517Q-YFP
Plasmid#29620DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmCherry2-CD86-mEYFP(Q69K)
Plasmid#190749PurposeExpression of CD86 double tagged with mCherry2 (N-term) and mEYFP(Q69K) (C-term) in mammalian cells.DepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R521H-YFP
Plasmid#29624DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHR-MCS-YFP-NLS
Plasmid#145274PurposeMammalian Expression of Nuclear YFP with N-terminal MCS and SV40 NLSDepositorInsertMCS and YFP
ExpressionMammalianAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-501aa-YFP
Plasmid#29601DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-EBFP2
Plasmid#158553PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-373aa-YFP
Plasmid#29598DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJRL2 PHO5pr VYFP (EB#1547)
Plasmid#14840DepositorAvailable SinceMay 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger1-TS-EYFP
Plasmid#127244PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-170aa-YFP
Plasmid#29596DepositorAvailable SinceApril 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.ChETA(E123T/H134R)-eYFP.WPRE.hGH
Plasmid#100049PurposeAAV expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by hSynap promoter for optogenetic activationDepositorHas ServiceAAV9InserthChR2(E123T/H134R)
UseAAVTagsEYFPExpressionMammalianMutationhumanized, E123T/H134RPromoterhSynapAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NES-YFP-CCTd
Plasmid#184326PurposeMammalian expression of the cytosolic localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTd
Plasmid#184325PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158) in pcDNAI/Amp
Plasmid#60888PurposeThis vector attaches YFP(1-158) to the N-terminus of a protein.DepositorInsertYFP(1-158)
ExpressionMammalianMutationMet was substituted for Gln-69.PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only