We narrowed to 6,180 results for: cas9 expression plasmid
-
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZ157
Plasmid#163639Purposepcn-1>PCN-1::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ186
Plasmid#163641Purposerps-27>DHB::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB:2xmKate2::3xHA
UseCRISPRTags2xmKate2ExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
BE3-P2A-EGFP (pJUL977)
Plasmid#123612PurposeCAG promoter expression plasmid for rAPOBEC1-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP.DepositorInsertBE3-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
Biomolecular FeedBack (FB)
Plasmid#109391PurposeThis construct encodes for two units. The first contains a constitutively expressed dCas9 protein. The second contains an sgRNA cassette under the control of the burden-responsive htpG1 promoter.DepositorInsertpJ23100mut-dCas9-T- phtpG1-sgRNA
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRExpressionMammalianPromoterU67Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-SpRY[C-term]-gRNAentry (CA20)
Plasmid#197511PurposeCbh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpRY and BsmBI entry cassette to clone SpCas9 gRNA spacerDepositorInsertAAV-[ITR]-pCbh-BPNLS-NpuC-SpRY[C-term]-BPNLS-gRNA[BsmBI]-pU6-[ITR]
UseAAV and CRISPRTagsBPNLS and BPNLS-NpuC(intein)MutationC-terminal mutations of SpRY(L1111R/D1135L/S1136W…PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V-NC-MS2
Plasmid#122944PurposeMS2 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an MS2 aptamer into lentivirus-like particlesDepositorInsertNC-MCP (MS2 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V-NC-PP7
Plasmid#122945PurposePP7 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an PP7 aptamer into lentivirus-like particlesDepositorInsertNC-PCP (PP7 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
P532_POU4F2-p2A-tdTomato-p2A-Thy1.2
Plasmid#239102PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of POU4F2 (aka BRN3B). This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertPOU4F2 (POU4F2 Human)
UseDonor plasmid for integration into the human geno…Tagsp2A-tdTomato-p2A-Thy1.2ExpressionMammalianPromoterEndogenous POU4F2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
CCND2 targeting gRNA
Plasmid#215318PurposeExpresses gRNA targeting CCND2 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND1 targeting gRNA
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mCherry-Cre-blast
Plasmid#179390PurposeLentiviral expression of Cre recombinase and mCherry reporter from CMV promoter (separated by P2A peptide), and blasticidin resistance gene for selection in mammalian cells.DepositorInsertmCherry (P2A) Cre recombinase
UseCre/Lox and LentiviralExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-SauriABE8e
Plasmid#189927PurposePlasmid encoding SauriABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertSauriABE8e
ExpressionMammalianMutationNme2Cas9 D16APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only