We narrowed to 18,742 results for: REV
-
Plasmid#22749DepositorAvailable SinceJune 2, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-1 shRev-Erbalpha
Plasmid#22747DepositorAvailable SinceFeb. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-EKARev
Plasmid#118474PurposeddRFP-based single-color biosensor for monitoring ERK activity.DepositorInsertRAB-EKARev
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceApril 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-rev-erbα
Plasmid#186823PurposeFluorescent reporter for rev-erbα expressionDepositorInsertrev-erbα promoter
UseLuciferasePromoterrev-erbα promoterAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iDreV
Plasmid#140136Purposecan be used to generate AAV virus that will express light-inducible site-specific iDreV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiDreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
JT113-pETDuet1-(R)-hREV3L
Plasmid#64872Purposebacterial expression of human REV3LDepositorAvailable SinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-HA_WT REV1
Plasmid#201586PurposeExpresses human DNA repair protein REV1 with an N-terminal HA tag in mammalian cellsDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-AKARev
Plasmid#118478PurposeddRFP-based single-color biosensor for monitoring PKA (Protein Kinase A) activity.DepositorInsertRAB-AKARev
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceApril 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCreV
Plasmid#140132Purposecan be used to generate AAV virus that will express fusion protein of split Cre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCreV
Plasmid#140131Purposecan be used to generate AAV virus that will express fusion protein of split Cre (N-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertNCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Rev(NL4.3)
Plasmid#115776PurposepCMV-RevNL4.3 allows the expression of Rev protein.DepositorInsertHIV-1 Rev protein (NL4.3)
ExpressionMammalianMutationNonePromoterCMVAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-EKARrEV-NLS
Plasmid#173855PurposeEncoding EKARrEV-NLS.DepositorInsertEKARrEV-NLS
ExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLTR.gp140/EGFP.Revdelta38/DsRed
Plasmid#115775PurposeHIV splicing reporter allows the assessment of the effect of LRAs on HIV-1 transcription and splicing.DepositorInsertEnvelope fused to EGFP (gp140-EGFP) and non-functional Rev protein fused to DsRed fluorescent protein (Rev-delta38-DsRed).
TagsEGFP; dsReDExpressionMammalianMutationgp140 uncleaved (1190-91aa, KR > TG; truncated…PromoterHIV-1 (LTR)Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbsr-EKARrEV-NLS
Plasmid#173854PurposeA lentiviral vector for EKARrEV-NLSDepositorInsertEKARrEV-NLS
UseLentiviralExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-EKARev(T/A)
Plasmid#118475PurposeNegative-control mutant for RAB-EKARev biosensor.DepositorInsertRAB-EKARev(T/A)
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1-N100
Plasmid#19848DepositorAvailable SinceJan. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S2-RAB_EKARev
Plasmid#160726PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter RAB-EKARev (ERK indicator), VSV-G tag, and S2 protein scaffold.DepositorInsertS2-RAB_EKARev
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S3-RAB_EKARev
Plasmid#160727PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter RAB-EKARev (ERK indicator), VSV-G tag, and S3 protein scaffold.DepositorInsertS3-RAB_EKARev
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-AKARev(T/A)
Plasmid#118479PurposeNegative-control mutant for RAB-AKARev biosensor.DepositorInsertRAB-AKARev(T/A)
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2A-EKAREV-NLS
Plasmid#173856PurposeEncoding EKAREV-NLS.DepositorInsertEKAREV-NLS
ExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CDreV
Plasmid#140133Purposecan be used to generate AAV virus that will express fusion protein of split Dre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCDreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-RevA-ss
Plasmid#137064PurposeE. coli expression clone (T7lac promoter) for mature RevA (aa 25-160) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationlacks the RevA signal peptide and 5 residues (CKA…PromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHU6_chr12_FAM19A2-up-gRNA-rev
Plasmid#81220PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locusDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMB36(revcomp)/Dvl1_1_670
Plasmid#40557DepositorAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6-Sp-gRNA-IDS_DF_D1b_attB_rev
Plasmid#182152PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-D1b-attB-rev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_C2c_attB_rev
Plasmid#182151PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-C2c-attBrev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch13_102010574-gRNA-rev
Plasmid#81219PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch13 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch12_62418577-gRNA-rev
Plasmid#81217PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sc rev7-pRS405/GAL
Plasmid#241259PurposeOver-express Sc rev7 (Sc Pol zeta subunit) in yeast (integrated)DepositorInsertrev7 (REV7 Budding Yeast)
ExpressionYeastAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rev7-Halo HRD
Plasmid#207079PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous REV7 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Brevican scFv [N294A/6]
Plasmid#206772PurposeMammalian Expression of Brevican scFV. Derived from hybridoma N294A/6 scFv.DepositorAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HIV-Rev_O
Plasmid#147111PurposeMammalian Expression of HIV-RevDepositorInsertHIV-Rev
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/6]
Plasmid#190309PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/6.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_Rev7_1-211_SA112_KVK_Champ1_328-355
Plasmid#105638PurposeExpresses mouse monomeric Rev7 and fragment of Champ1 protein (amino acids 328-355) from bicistronic plasmidDepositorExpressionBacterialMutationMutations: F11S, G12A, V132K, C133V, A135KPromoterT7Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPrev
Plasmid#158060PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRevA-TEV-His12
Plasmid#137034Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi RevA with C-terminal TEV-protease-cleavable His12DepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch5_155183064-gRNA-rev
Plasmid#81215PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch5 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-REVERBA-mScarlet-NLS-PEST
Plasmid#190658PurposeFluorescent reporter for circadian rhythmsDepositorInsertReverba-mScarlet (Nr1d1 Mouse)
ExpressionMammalianAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-FRT/TO-eGFP-REV7
Plasmid#114128PurposeExpresses N-terminally tagged eGFP-REV7 in mammalian cellsDepositorInsertREV7 (MAD2L2 Human)
UseGenomic integration, tetracycline inducibleTagseGFPExpressionMammalianPromoterCMV/TetO2Available SinceAug. 15, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits