We narrowed to 1,064 results for: Superfolder GFP
-
Plasmid#160466PurposeEncodes a fusion of human proinsulin and the monomeric superfolder GFP2DepositorInsertproinsulin-msGFP2
ExpressionBacterialPromoterT5Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-sfGFP
Plasmid#133568PurposeCAG sfGFP piggyBac transposonDepositorInsertsfGFP
ExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTHSSe_50
Plasmid#109248PurposeincW BbsI cloning vectorDepositorInsertsfGFP
ExpressionBacterialPromoterPJ23105Available SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHSSe_60
Plasmid#109254PurposeTALEsp2 stabilized promoter driving GFPDepositorInsertsfGFP
ExpressionBacterialPromoterTALEsp2 stabilized promoterAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHSSe_59
Plasmid#109253PurposeTALEsp1 stabilized promoter driving GFPDepositorInsertsfGFP
ExpressionBacterialPromoterTALEsp1 stabilized promoterAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGPF 150TAG
Plasmid#154765Purposeplasmid with amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGT-B1
Plasmid#122579PurposeMAGIC donor plasmid (pBBR1 oriR with beta-lactamase/sfGFP payload)DepositorInsertsfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MCS-P2A-sfGFP
Plasmid#74668PurposePlasmid for expression of wild-type or mutant cDNA fragments (mutation reporter) or complete cDNAs in frame with superfolderGFP.DepositorInsertsfGFP
ExpressionMammalianAvailable SinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVoPo-GFP
Plasmid#187840PurposeConstitutive GFP-expression vector for Fusobacterium nucleatumDepositorInsertsfGFP
ExpressionBacterialAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKD237-3a-2
Plasmid#90957PurposeExpresses ThsR and mCherry constitutively and sfGFP under the PphsA promoterDepositorInsertsThiosulfate response regulator
Superfolder GFP
mCherry
ExpressionBacterialPromoterBba_J23100, Bba_J23105, and PphsAAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pG1AK-sfGFP
Plasmid#71739PurposeModular shuttle vector for Geobacillus and E. coliDepositorInsertsfGFP
UseSynthetic Biology; Shuttle vectorExpressionBacterialPromoterpRplsWTAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMTB
Plasmid#112225PurposeExpression of membrane-tagged super folder GFP from zebrafish beta-actin promoter.DepositorInsertSuper-folder GFP
UseZebrafish expressionPromoterbeta actin 2 (zebrafish)Available SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pM2s2AsG
Plasmid#137924PurposeE. coli Nissle pMUT2-derived plasmid with ampicillin resistance and constitutive GFP expressionDepositorInsertSuperfolder GFP
UseSynthetic Biology; For use with e. coli nissle in…ExpressionBacterialPromoterJ23101Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJBL-RNAINS4
Plasmid#69456PurposeRNA-IN S4 variant 5' UTR sequence controlling expression of superfolder GFP (UTR sequence from Mutalik et al., Nat. Chem. Biol., 2012)DepositorInsertRNA-IN S4 + SFGFP
UseSynthetic BiologyExpressionBacterialMutationmutations for S4 variant (from wt)PromoterJ23119 and J23119 (sigma 70)Available SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBA409
Plasmid#85971PurposeEF1a-sfGFP-Ubc-NeoDepositorInsertssfGFP
Neo
UseLentiviralExpressionMammalianAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xHRE_minCMV-sfGFP-CMV_dsRed Exp
Plasmid#117401PurposesfGFP expressed from hypoxia-inducible minimal CMV promoter and dsRed expressed from consitutive CMV promoterDepositorInsertSuperFolder GFP
ExpressionMammalianAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only