We narrowed to 71,472 results for: nin
-
Plasmid#191054Purposemec-3 fluorescent neural reporter driving nuclear CyOFP1 and mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAGM35171
Plasmid#153222PurposeLevel 1 position 1 part containing the Nos promoter, the BAR gene, and the Ocs terminatorDepositorInsertNos promoter, BAR gene, Ocs terminator
UseSynthetic BiologyAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEY52
Plasmid#191055Purposeodr-1 fluorescent neural reporter driving nuclear mNeptune2.5 and mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HB501: pMVP (L1-L4) RIP
Plasmid#121688PurposepMVP L1-L4 entry plasmid, contains rat Ins1 promoter (RIP) for 3-component MultiSite Gateway Pro assemblyDepositorInsertRat Ins1 promoter (RIP; β-cell specific)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAGM65905
Plasmid#153217PurposeLevel 2 cloning vector for one or several guide RNAs, already contains Cas9 and a kanamycin selection cassette for plant transformationDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pME18ST-d5-HT7
Plasmid#53111PurposeExpression of Drosophila 5-HT7DepositorInsert5HT7 (5-HT7 Fly)
Available SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHS1398
Plasmid#205971PurposeMWEE01000013 Cas5-HNH crRNA expression in pCOLADuet-1DepositorInsertCas5-HNH crRNA
ExpressionBacterialPromoterT7Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS1182
Plasmid#205964PurposeNZ_CP025815 DinG HNH crRNA expression in pCOLADuet-1DepositorInsertDinG HNH crRNA
ExpressionBacterialPromoterT7Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CT3G-ERP2-MG-IRES2-mNeonGreen
Plasmid#175506PurposeAll-in-one piggyBac transposon destination vector for mCMV+dox-inducible expression of Mega Gate cloned elements upstream of IRES2-mNeonGreen (hEF1a-driven rtTA and puromycin resistance)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterTRE3G-mCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LD101: pMVP (L3-L2) eCFP + WPRE
Plasmid#121775PurposepMVP L3-L2 entry plasmid, contains eCFP + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eCFP fusion to gene of interest in lentivirus vectors.DepositorInserteCFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-XLF
Plasmid#207546PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XLF locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human Lig4 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRT/FLAG/HA-DEST EIF2C4
Plasmid#19890DepositorInsertEukaryotic translation initiation factor 2C, 4 (AGO4 Human)
TagsFLAG/HAExpressionMammalianAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pT7-HISx6-SIMx6
Plasmid#116938PurposeBacterial expression vector for 6 simDepositorInsert6 sim
ExpressionBacterialPromoterT7Available SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-HISx6-SUMOx10
Plasmid#116937PurposeBacterial expression vector for 10 sumoDepositorInsert10 SUMO
TagsHISExpressionBacterialPromoterT7Available SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
IA001: pMVP (L3-L2) 3x HA epitope tag+ polyA
Plasmid#121750PurposepMVP L3-L2 entry plasmid, contains 3x HA epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsert3x HA epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR H1-miR-30 L1-R5
Plasmid#62181PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a H1 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST-FRT-TO-GFP-PALB2 KR
Plasmid#71107Purposemammalian expression of GFP-PALB2 mutant. (first 8 Lysine residues mutated to Arginine)DepositorInsertPALB2 (PALB2 Human)
TagsGFPExpressionMammalianMutationfirst 8 Lysine residues mutated to Arginine (K14-…PromoterCMV/TOAvailable SinceDec. 2, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHD-3xP3-dsRed-DattP
Plasmid#133559PurposeBackbone vector for CRISPR-HDR insertion of SPARC-Variant constructsDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pME18ST-d5-HT1B
Plasmid#53108PurposeExpression of Drosophila 5-HT1BDepositorInsert5HT1B (5-HT1B Fly)
Available SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only