We narrowed to 14,812 results for: NTS;
-
Plasmid#153270PurposeM4E shuttle vector containing the Solanum lycopersicum U3 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pMOD_B2615
Plasmid#91078PurposeModule B, Promoter: AtU6, Gene: BsaI ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertBsaI ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_attR1-ORF-attR2-NTEV-TCS-GV-2xHA_DEST
Plasmid#194385PurposeGateway Destination vector for split TEV assaysDepositorInsertattR1-ORF-attR2-NTEV-TCS-GV-2xHA
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1
Plasmid#126770PurposeExpression of increased fidelity SpCas9-HF1 in bacterial cellsDepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A, R661A, Q695A, Q926APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCVL Traffic Light Reporter 1.1 (Ani target) Ef1a Puro
Plasmid#31480DepositorInsertTraffic Light Reporter 1.1 (ani target)
UseLentiviralMutationmCherry has M9S, M16L to reduce background mCherr…Available SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO_H2B_HaloTag9
Plasmid#169334PurposeNuclear expression of HaloTag9 in mammalian cellsDepositorInsertH2B-HaloTag9 (H2BC21 Human)
TagsHaloTag9ExpressionMammalianMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pb459-mU6-sgRNA-EF1a-PuroR
Plasmid#195507Purposepiggybac vector expressing non-targeting control sgRNA cloned using BlpI and BstXI sitesDepositorInsertPuromycin
UseCRISPR; PiggybacExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-LLO-SIINFEKL
Plasmid#174598Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and SIINFEKL epitopesDepositorInsertmembrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-NtLAtC60αβC20
Plasmid#160873PurposeExpression of N. tabacum Rubisco large subunit and A. thaliana Rubisco chaperone protiens cpn60α, cpn60β, cpn20 in E. coliDepositorInsertrbcL, cpn60α, cpn60β, cpn20
ExpressionBacterialPromoterrbcL: pBAD, chaperones: T7Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGE463
Plasmid#153234PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-133a-1
Plasmid#46676DepositorInserthsa-mir-133a-1 (MIR133A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
GalT-moxDendra2
Plasmid#89789Purposemammalian expression of GC localized moxDendra2DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGWB421
Plasmid#74815PurposeGateway cloning compatible binary vector for N-terminal fusion with 10xMyc (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA15-Ubc-NLS- scFV-tdTomato
Plasmid#199446PurposeExpression of scFV-tdTomato that binds to the GCN4 peptide from the SunTag System in mammalian cellsDepositorInsertscFV-tdTomato
UseLentiviralExpressionMammalianPromoterhuman ubiquitin C (UBC)Available SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0402
Plasmid#91009PurposeModule A, Promoter: AtUbi10, Gene: AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertAtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterAtUbi10Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only