We narrowed to 12,776 results for: NUC
-
Plasmid#127662PurposeOver-express catalytically inactive EGFP-FLAG-cGAS E225A/D227ADepositorAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE
Plasmid#179459PurposeDouble floxed soma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector expressed under the mammalian promoter (EF1a)DepositorHas ServiceAAV1InsertJEDI-2P-Kv
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin-S41E
Plasmid#186748PurposeExpresses S41E phosphomimetic GFP-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsGFPExpressionMammalianMutationChanged serine 41 to glutamic acidPromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin-S41A
Plasmid#186749PurposeExpresses S41A phosphodead GFP-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsGFPExpressionMammalianMutationChanged serine 41 to alaninePromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-Cofilin-S41E
Plasmid#186751PurposeExpresses S41E phosphomimetic mCherry-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsmCherryExpressionMammalianMutationChanged serine 41 to glutamic acidPromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1-FSF-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpA
Plasmid#65454PurposeCan be used to generate AAV virus that will express the ChR2(H134R)-EYFP channelrhodopsin fusion protein in neurons under intersectional control by Flp and Cre recombinasesDepositorInsertChR2(H134R)-EYFP
UseAAVTagsEYFPMutationH134R variantPromoterhSyn1Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-SRSF1-V5-mCherry
Plasmid#235089PurposeSRSF1 mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_hNT
Plasmid#71830PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cellsDepositorInsertNon-targeting sgRNA human (DNMT3A S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE
Plasmid#179463PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P-Kv
UseAAVExpressionMammalianPromoterhSynAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human 3' HP1a AID GFP PuroR
Plasmid#127906PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Human HP1a GeneDepositorInsertHP1 (CBX5 Human, Mustard Weed)
UseDonor plasmidTagsGFP, AID, PuroRMutationInserting GFP AID 2A Puro into mouse 3' Hp1aAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term FBL
Plasmid#187577PurposeExpress FLAG epitope and APEX2-tagged FBL fusion protein in mammalian cellsDepositorAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR2b-V5
Plasmid#236014Purposefor PiggyBac mediated integration and stable expression of hFGFR2b proteinDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 C-term EWSR1
Plasmid#187586PurposeExpress FLAG epitope and APEX2-tagged EWSR1 fusion protein in mammalian cellsDepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-BrCas12b-FNLDTA
Plasmid#195340PurposeExpresses Engineered BrCas12b in BacteriaDepositorInsertBrCas12b
UseCRISPR and Synthetic BiologyTags6xHis Tag and MBP, TEV cleavage site, 6x His TagExpressionBacterialMutationF208W, N524V, L795I, D868V, T874S, A1015EPromoterT7 PromoterAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-Kv-WPRE
Plasmid#179465PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P-Kv
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBactin-PACT-mOrange2-hCM1
Plasmid#196868PurposeExpression of Pericentrin-AKAP450 centrosomal targeting (PACT) domain fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). PACT targets CM1 to the centrosomeDepositorInsertPACT-mOrange2-hCM1 (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-Lbr-V5-mCherry
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-HTR6-RhoA sensor
Plasmid#189614PurposeTet-On cilia-targeted RhoA sensor (Xlone piggybac back-bone); HTR6-fused with a sGFP-mScarlet-I based sensorDepositorAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-2P-WPRE
Plasmid#179469PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-2P
UseAAVExpressionMammalianPromoterGFAPAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8 (ANV)
Plasmid#71829PurposeExpression of mutant dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-PuroR and specific sgRNA for the human BACH2 promoter; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL1 sgRNA(MS2)-MS2-AIDmono
Plasmid#112127Purposeempty sgRNA cloning vector with MS2-AIDmonoDepositorInsertAID mono mutant (AICDA Human)
UseCRISPRExpressionMammalianMutationN- mutated and C- terminal truncated, H130A/R131E…PromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2P-Kv
Plasmid#179462PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2P-Kv
ExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-ePhi29(+exo) (LM2990)
Plasmid#208958PurposeA variant CE1 construct with ePhi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-ePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); ePhi29(M8R/V51A/M97T/G197D/E221K/…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-WPRE
Plasmid#179466PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Halo-Tag-128-425-Akap9
Plasmid#196873PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to Halo-Tag. Used to displace endogenous Akap9 from GolgiDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUltraHot-mCherry-BLM-WT
Plasmid#206966Purposeexpressing the protein BLM fused to mCherry in human cellsDepositorInsertBloom Syndrome RecQ Like Helicase (BLM Human)
UseLentiviralTagsmCherryExpressionMammalianAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only