We narrowed to 7,760 results for: tet on
-
-
pYPQ134-tRNA2.0
Plasmid#158396PurposeGolden Gate entry vector to express the 4th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135-tRNA2.0
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136-tRNA2.0
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pDAI-SceI-SacB
Plasmid#113635PurposeBroad host range replicative plasmid expressing the I-SceI homing endonuclease and the counterselectable marker SacBDepositorInsertsacB
ExpressionBacterialMutationPlease see Depositor CommentsPromotersacB promoterAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
pZH509
Plasmid#102664PurposeTetracycline inducible expression of GFPmut2 using bicistronic autoregulation; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-OTUD5
Plasmid#22610DepositorAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-eGFP
Plasmid#157733Purposemammalian expression of untagged eGFP under control of a tetracycline-inducible promoterDepositorInserteGFP
ExpressionMammalianAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B2.0
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GCaMP6s
Plasmid#166606PurposeEncodes Cre-dependent GCaMP6s under control of the TREDepositorInsertGCaMP6s
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-crRNA-Km
Plasmid#158712PurposePlasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells and a non-targeting crRNADepositorInsertAcGFP (for crRNA cloning)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterTetOAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2H12Matry
Plasmid#221143PurposecdGreen-Matry expressed from an aTc-inducible promoter (Internal Lab ID: UJ11208)DepositorInsertcdGreen-Matry
ExpressionBacterialPromoterPtetAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA
Plasmid#108236PurposeBroad host bacterial expression vector with constitutive PsbA promoterDepositorInsertPsbA promoter
ExpressionBacterialAvailable SinceMay 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Lifeact_Halo_T2A_EGFP
Plasmid#135445PurposeMamalian cell expression of HaloTag7 localized at F-actin and cytosolic EGFPDepositorInsertLifact-HaloTag7 and EGFP
TagsLifactExpressionMammalianPromoterCMV/TetOAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDAI-SceI-pheS
Plasmid#111611PurposeYeast homing endonuclease I - SceI expression vector. Used for resolution of merodiploids during allelic exchange in Burkholderia sp.DepositorInsertpheS
ExpressionBacterialAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only