We narrowed to 15,674 results for: grna
-
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only
-
PEA1-GFP
Plasmid#171993PurposeDelivers all prime editing nickase components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-spe
Plasmid#122000PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_Blast
Plasmid#125592PurposeLentiviral expression of spCas9 with blasticidin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GSK3β-#1
Plasmid#32496DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.PKCepsilon.RNAi
Plasmid#10798DepositorAvailable SinceApril 7, 2006AvailabilityAcademic Institutions and Nonprofits only -
pXJ512-pAAV-PB3'IR-CAG-MCP-mtagBFP-KASH-6XMS2-dual sgRNA-PB5'IR
Plasmid#254952PurposeAAV piggyBac vector with dual gRNAs and CAG-driven MCP-mtagBFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertMCP-mtagBFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ515-pAAV-PB3'IR-CAG-PCP-mtagBFP-KASH-6XPP7-dual sgRNA-PB5'IR
Plasmid#254954PurposeAAV piggyBac vector with dual gRNAs and CAG-driven PCP-mtagBFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-mtagBFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ520-pAAV-PB3'IR-CAG-MCP-GFP-KASH-6XMS2-hU6-gRNA-PB5'IR
Plasmid#254955PurposeAAV piggyBac vector with single gRNA and CAG-driven MCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertMCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ521-pAAV-PB3'IR-CAG-PCP-GFP-KASH-6XPP7-hU6-gRNA-PB5'IR
Plasmid#254956PurposeAAV piggyBac vector with single gRNA and CAG-driven PCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ496-pAAV-PB3'IR-CAG-PCP-GFP-KASH-6XPP7-dual sgRNA-PB5'IR
Plasmid#254950PurposeAAV piggyBac vector with dual gRNAs and CAG-driven PCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ511-pAAV-PB3'IR-CAG-MCP-mScarlet-KASH-6XMS2-dual sgRNA-PB5'IR
Plasmid#254951PurposeAAV piggyBac vector with dual gRNAs and CAG-driven MCP-mScarlet-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertMCP-mScarlet-KASH
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse DGCR8-1
Plasmid#14772DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
AdML-M3
Plasmid#11244DepositorInsertAdML-M3
Tags3 MS2 hairpinsExpressionBacterialAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTZ tRNA_gRNA empty scaffold
Plasmid#188450PurposeExpression of gRNAs using a human tRNA promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotertRNA glutamineAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only