We narrowed to 10,006 results for: Gnas
-
Plasmid#98346PurposeLentiviral expression of IQGAP1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pTRIP-UbC-Blast-2A-STING-mNeonGreen
Plasmid#227185PurposeLentiviral expression plasmid encoding STING-mNeonGreen under UbC promoterDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_P2A_Puro
Plasmid#211364PurposeLentiviral expression vector for an insert of interest linked to a P2A-T2A puromycin sequence. Produces virus very efficiently. Can also be used for regular transfectionsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-AREG-ScNeo
Plasmid#209910PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human Wild-type ASAP1
Plasmid#235212PurposeExpresses Wild-Type ASAP1 in mammalian cellsDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
FAS_pLX307
Plasmid#98334PurposeLentiviral expression of FASDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 K231R
Plasmid#80884Purposemammalian expression of ALK6 K231RDepositorInsertALK6 (Bmpr1b Mouse)
TagsHAExpressionMammalianMutationK231R (kinase-deficient)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-TurboID
Plasmid#204713PurposeExpresses C-terminal TurboID tagged human STING for proximity ligation.DepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.3.1.ADRB2-NP
Plasmid#134376PurposeNanoluc complementation assay. Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of signal sequence and Flag epitope at N terminus of ADRB2.DepositorInsertADRB2-NP (ADRB2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUltra-Hot-PC
Plasmid#184466PurposeLentiviral vector for bi-cistronic expression of mCherry and PC (seperated by P2A)DepositorAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-PABPC1
Plasmid#232944PurposeExpresses PABPC1 proteinDepositorInsertPABPC1 (PABPC1 Human)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGS-FCER1G-1
Plasmid#109192PurposeEncodes human full-length FCER1G to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mVenus-TOSI
Plasmid#172491PurposemVenus-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mCherry-TOSI
Plasmid#172496PurposemCherry-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N3-EPAC1
Plasmid#113110PurposeHuman EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).DepositorAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only