We narrowed to 7,428 results for: Tet-on
-
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAB822
Plasmid#47856PurposeBIOFAB reporter plasmid for measuring BBa_B1006 termination efficiencyDepositorInsertBBa_B1006 terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO11Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB803
Plasmid#47847PurposeBIOFAB reporter plasmid for measuring T7 early termination efficiencyDepositorInsertT7 early terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO2Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
NLS-dCas9-HA-NLS-GFP4-VPR
Plasmid#183924PurposeVPR activation domain coupled to catalytically inactive dCas9 for localization; contains a GFP tetramer fpr labeling and as a spacerDepositorInsertdCas9-GFP4-VPR
UseCRISPRTagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEos2-CD151-7
Plasmid#57358PurposeLocalization: Tetraspanin/Membrane, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPyCAG-NE-EGFP-IRES-Pac
Plasmid#183617PurposeMammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered EGFP (NLS-EGFP-EmerinTMD). Confers puromycin resistance.DepositorInsertEGFP
TagsHuman EMD transmembrane domain and NLSExpressionMammalianPromoterCAGAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5B3-T
Plasmid#92021PurposeExpresses TALE targeted to lysA promoter with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lysA with N-terminal TEV protease cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-HcRed
Plasmid#67035PurposePlasmid for Paph-HcRed integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
HcRed
UseConjugative bacterial vectorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFE-vcDAB
Plasmid#133004PurposepFE carrying the vcdabA2 ( locus_tag: CSW01_RS07960) and vcdabB2 genes (locus_tag: CSW01_RS07955)DepositorInsertsvcdabB
vcdabA
ExpressionBacterialPromotertetRAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRD21A-mRFP
Plasmid#181959PurposeRD21A protein tagged with mRFP, under control of native promoterDepositorInsertRD21A genomic sequence including 2kb upstream of the ATG
TagsmRFPExpressionPlantPromoterRD21A nativeAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)
Plasmid#111255PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorT signal peptideDepositorInsertTorT signal peptide
ExpressionBacterialPromoterPcAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219V, C151AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[LacI-L]
Plasmid#60745PurposeContains PI driving expression dimeric LacI, the Lactose inducible repressor.DepositorInsertLacI
UseSynthetic BiologyExpressionBacterialMutationwt LacI without the tetramerization domainAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5A7-T
Plasmid#92020PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain and a second in the C-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N and C-terminal TEV protease cleavage sites
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only