We narrowed to 11,499 results for: ARIA;
-
Plasmid#210357PurposeExpresses FKBP10 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only
-
DNAJC11-2Strep
Plasmid#210354PurposeExpresses DNAJC11 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST AO7RE ∆238-245
Plasmid#139318PurposeGST tagged AO7 encoding aa 126-258 with an internal deletion that results in loss of E2 binding for expression in bacteriaDepositorInsertAO7 aa 126-258 (RNF25 Human)
TagsGSTExpressionBacterialMutationAO7 cloned into the first multiple cloning site o…PromoterT7 promoter-1Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNK005C_BattB_mkozak_STIM1_IRES_mCherry-H2A-P2A-PuroR
Plasmid#200639PurposeLow STIM1 abundance recombination plasmid for Matreyek Bxb1(GT) landing pad in dual landing pad cellsDepositorInsertSTIM1 (STIM1 Human)
ExpressionMammalianAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LYK5_At-3xHA
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
TagsHAExpressionPlantPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#1
Plasmid#197421PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #1 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#2
Plasmid#197422PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#3
Plasmid#197423PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #3 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-In18runon-PTPN22
Plasmid#195377PurposeA human PTPN22 mutant (intron 18-runon) in Gateway pDONR221DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-In18runon-PTPN22
Plasmid#195379PurposeMammalian expression of a human PTPN22 mutant (intron 18-runon) with FLAG tagDepositorAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-PTPN22
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2
Plasmid#185346PurposeMembrane anchoring of UBE2G2. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2DepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2-FLAG
Plasmid#185347PurposeMembrane anchoring of UBE2G2 and co-IP. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2 with C-terminal FLAG tagDepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
TagsFLAGExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HTR2A-NTEV-TCS-GV-2xHA
Plasmid#194366PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only