We narrowed to 12,276 results for: shRNA
-
Plasmid#240637PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and mCherry from the EF1Alpha promoter.DepositorInsertpuro-T2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna3-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128338PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP1187
Plasmid#119256Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Lb
Plasmid#86197PurposeLbCpf1 Gateway gRNA entry plasmid using Zea mays Ubi promoter and ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRPromoterMaize ubiquitin 1Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-shRab27a
Plasmid#120930Purposeconditionally knockdown Rab27a in mouse cell linesDepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(wt)
Plasmid#107614PurposeN-terminal half of π-EB1 with wild-type LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain and GCN4 leuc…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
plenti_DCLK1
Plasmid#163625PurposeExpresses DCLK1DepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMJ114
Plasmid#85995PurposeOne-guide Perturb-seq vector backbone; modified bovine U6 promoter; original constant regionDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified bovine U6-2Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001148430)
Plasmid#77279Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v1-mU6-sgCebpb_v1-hU6-sgCebpd_v1
Plasmid#177257PurposeExpresses Cebpa_v1 (bU6), Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1/sgCebpd_v1
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ117
Plasmid#85997PurposeOne-guide Perturb-seq vector backbone; modified human U6 promoter; constant region 3DepositorInsertsEGFP-NT2_cr3
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified human U6Available SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo sgTREX1
Plasmid#127645PurposeKnock-out of human TREX1 with NeoRDepositorInsertTREX1 sgRNA (TREX1 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMJ179
Plasmid#85996PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2DepositorInsertsEGFP-NT2_cr2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified mouse U6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgALCAM
Plasmid#83929PurposeLentiviral vector expressing an sgRNA targeting ALCAM. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgALCAM
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ch-TOGKDP-GFP
Plasmid#69112PurposeFor mammalian expression of knockdown-proof human ch-TOG tagged with EGFP.DepositorInsertColonic Hepatic Tumour Over-expressed Gene (CKAP5 Human)
TagsEGFPExpressionMammalianMutationSilent mutations to confer shRNA resistance.PromoterCMVAvailable SinceOct. 13, 2015AvailabilityAcademic Institutions and Nonprofits only