We narrowed to 9,071 results for: sgRNA
-
Plasmid#66584PurposesgRNA for iGFPDepositorPublicationInsertiGFP
ExpressionMammalianAvailable sinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330.iGFP2
Plasmid#66582PurposesgRNA for iGFPDepositorPublicationInsertiGFP
ExpressionMammalianAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330.Pten.b
Plasmid#66588PurposesgRNA for Pten deletionDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPten deletion (Pten Mouse)
ExpressionMammalianAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330.LoxPO
Plasmid#66585PurposesgRNA for LSLDepositorPublicationInsertLSL-Tomato
ExpressionMammalianAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458-3xHA-FnCas9
Plasmid#130969Purpose3xHA tagged Cas9 from F. novicida with T2A-EGFP and cloning backbone for sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFnCas9
UseCRISPRTags3xHA-NLS and NLS-T2A-EGFPExpressionMammalianPromoterCbhAvailable sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiCRISPR v2-sgLKB1 clone3
Plasmid#162127PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE503
Plasmid#153276PurposeIntermediate sgRNA array cloning vector position 1DepositorTypeEmpty backboneUseCRISPRAvailable sinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE508
Plasmid#153280PurposeEnd-linker for cloning 2 sgRNA arrays into any recipient vectorDepositorInsertlinker
UseCRISPRAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNSA-ARS-CRISPR-BlastR
Plasmid#101009PurposeExpresses Cas9-Nlux and sgRNA and contains CEN/ARS. CCMP537 LDSP promoter driven Blasticidin resistance gene.DepositorTypeEmpty backboneUseAlgae, nannochloropsisAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11
Plasmid#207758PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2BC11 Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Bmal1
Plasmid#168296PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgBmal1-1-hU6-sgBmal1-3
UseAAVTagsmCherryPromoterU6, hSynAvailable sinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS263
Plasmid#122379PurposeCRISPRi plasmid for HSP90 depletion in Candida albicans. Contains dCas9-Mxi1 and NEUT5L integration site and an sgRNA targeting -141 bp upstream of HSP90 start codonDepositorInsertHSP90
UseCRISPRExpressionYeastAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS267
Plasmid#122380PurposeCRISPRi plasmid for HSP90 depletion in Candida albicans. Contains dCas9-Mxi1 and NEUT5L integration site and an sgRNA targeting -112 bp upstream of HSP90 start codonDepositorInsertHSP90
UseCRISPRExpressionYeastAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA2601_eSpCas9-G2P
Plasmid#124203PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only