We narrowed to 12,276 results for: shRNA
-
Plasmid#119242Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP2
Plasmid#79874PurposeBacillus subtilis sgRNA expression vector; integrates into amyEDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149198)
Plasmid#80248Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7501 pHR (hU6-crNT-EFS-PuroR-WPRE)
Plasmid#214876PurposeLentiviral vector encoding RfxCas13d nontargeting control guideDepositorInserthU6-crNT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TYMS_sgRNA1
Plasmid#201628PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTYMS (TYMS Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK4/GCN2_sgRNA
Plasmid#218528PurposesgRNA targeting human EIF2AK4/GCN2DepositorInsertEIF2AK4 (EIF2AK4 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
Plasmid#89060PurposeAAV-gRNA cloning vector with GFP reporterDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_CDC45
Plasmid#244243PurposeExpresses SpCas9 and a sgRNA targeting the human CDC45 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only