We narrowed to 10,769 results for: ESP
-
Plasmid#222886PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2129-FRB-GPA-114-5-CyOFP1
Plasmid#222888PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2128-FRB-GPA-114-10-CyOFP1
Plasmid#222887PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2131-FKBP-GPA-114-10-CyOFP1
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1
Plasmid#159531PurposeExpresses Arabidopsis thaliana VERNALIZATION1 in E. coliDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71102
Plasmid#154065PurposeLevel 0 Golden Gate vector; Unmodifed CREDepositorInsertCRE
UseSynthetic Biology; Standard cloning vector used b…MutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
KHBD00016
Plasmid#34178DepositorInsertCG8361 (E(spl)m7-HLH Fly)
UseGateway donor vectorAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP NeoR
Plasmid#128960PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHS1-M7A,H102A
Plasmid#159171PurposeHuman codon-optimized cytosolic labile heme reporterDepositorInserthHS1-M7A,H102A
ExpressionMammalianMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ARR3tk-eGFP/SV40-mCherry
Plasmid#132360PurposeTo measure transcriptional activity of Androgen ReceptorDepositorInsertAR responsive elements (AR Human)
UseLentiviralAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-s ONE-GO
Plasmid#189731PurposeGPCR/G protein BRET biosensorDepositorInsertsUseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Luciferase
Plasmid#213979PurposeExpresses Doxy Inducible LuciferaseDepositorInsertLuciferase
UseLentiviralTags6xHis affinity tagExpressionBacterial and MammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pRRL-SFFV-rtTA3-IRES-Luc-P2A-mtagBFP
Plasmid#176027Purposeconstruct expresses the reverse tet-responsive transactivator 3 (rtTA3) together with Luciferase (Luc) for bioluminescence in vivo imaging, and mTaqBFP for enriching transgenic cells by flow cytometryDepositorInsertsrtTA3
Luc2
mtagBFP
UseLentiviralAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
YY171: pPB_NFκB::GFP-GEMINI(A)_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228883PurposePiggyBac plasmid expressing the GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
Str-STIM1-NN_puromycin
Plasmid#65310PurposeLuminal ER hook only (RUSH system)DepositorInsertSTIM1 mutated for binding motif to microtubule (STIM1 Human)
TagsstreptavidinExpressionMammalianMutation2 amino acids of STIM1 (IP from SxIP motif) were …PromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEN396 - pCAGGS-Tir1-V5-2A-PuroR TIGRE donor
Plasmid#92142PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection (2A-fusion). Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO (pEHA1339)
Plasmid#209088PurposeBackbone plasmid for Tet Responsive transgene expression, FRT integrationDepositorTypeEmpty backboneExpressionMammalianAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Progerin
Plasmid#69061Purposeencodes the lamin A mutant with a 50 amino acids deletion responsible for the Hutchinson-Gilford Progeria SyndromeDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mGreenLantern-KASH
Plasmid#191094PurposeTo express a bright monomeric green FP to label the eucaryotic nuclear envelope. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmGreenLantern-KASH
UseAAV and Synthetic BiologyTagsmGreenLantern fused to the KASH domain of Nesprin…ExpressionMammalianMutationOptimizzation was done using the Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-osTIR1
Plasmid#207840PurposeInducible TIR1 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsosTIR
mCherry
mAID_-VHH-GFP4
Tags3X HA-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-AUP1-FLAG DTM
Plasmid#185337PurposeAssessing domain requirements of AUP1DepositorInsertAUP1 (AUP1 Human)
TagsFLAG, 6xHisExpressionMammalianMutationdeletion of aa 24-45, corresponding to the hairpi…Available SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGF1-4eCOL2A1
Plasmid#97210PurposeLentiviral expression of copGFP-T2A-FLuc under control of a COL2A1-based, chondrogenesis-responsive promoterDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseLentiviral and LuciferaseExpressionMammalianPromoterCOL2A1 regulatory elementsAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only