We narrowed to 26,401 results for: Vit
-
Plasmid#178874PurposeMammalian expression of PB1-MontiRed-LOV2darkDepositorInsertPB1-MontiRed-LOV2dark
ExpressionMammalianMutationLOV2: C450A, L514K, G528A, L531E, N538EPromoterCAGAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fTCAP-GFP
Plasmid#22916DepositorInsertfugu titan cap promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
myc-hIFITM3-F63Q
Plasmid#104363PurposeExpresses human IFITM3-F63Q with an N-terminal myc tag in mammalian cells.DepositorInsertIFITM3 (IFITM3 Human)
TagsmycExpressionMammalianMutationmutated the following amino acid: F63QPromoterCMVAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
AB.pCCL.sin.cPPT.U6.miR-16-Decoy.hPGK.GFP.WPRE
Plasmid#46593DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGex-3x Flag MKK3
Plasmid#14814DepositorAvailable SinceJuly 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRS316-RGR-GFP-mm
Plasmid#51059PurposeSame as pRS316-RGR-GFP except for the HH ribozyme region which has a 13 bp deletion at its 5' end, and for the HDV ribozyme region which has a 15 bp deletion at its 3' end.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP86
Plasmid#83543PurposeUsed to evaluate the expression output of RPL4A promoter with yEGFP used as the reporter gene.DepositorInsertRPL4A promoter-yEGFP
ExpressionYeastPromoterRPL4AAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR-GFP-Patronin CC+CKK
Plasmid#59048Purposefor baculovirus expression of Patronin CC+CKK (using Baculodirect kit from Invitrogen)DepositorAvailable SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR-GFP-Patronin CC 534–1457
Plasmid#59050Purposefor baculovirus expression of Patronin CC truncation (using Baculodirect kit from Invitrogen)DepositorAvailable SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG.Lantern-SM50-GFP
Plasmid#135593PurposeExpression of SM50 Promoter-GFP mRNA for microinjection to visualize SM50 promoter activity in S. purpuratusDepositorInsertSM50 promoter (SM50 S. purpuratus)
UseIn vitro transcription (mrna synthesis)TagsGreen Lantern GFPPromoterCMVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b+R3(R112C/T180C)
Plasmid#108195PurposeExpresses PdR-PCNA3(R112C/T180C) fusion protein in E. coliDepositorInsertPdR-PCNA3(R112C/T180C) fusion protein
TagsHis6 tagExpressionBacterialMutationR112C/T180C(PCNA3)PromoterT7 promoterAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS316-RGR-GFP-mHDV
Plasmid#51058PurposeSame as pRS316-RGR-GFP except for the HDV ribozyme region which has a 15 bp deletion at its 3' end.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pWP1_mFTCD
Plasmid#102317Purposeexpression of mouse cDNA of FTCD, refractory to the guides in plasmids 1,2DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS-TRE-cofilin1(S3A)-P2A-mTurquoise2
Plasmid#163610PurposeExpresses constitutively active cofilin and mTurquoise2 under the TRE promoter in mammalian cellsDepositorAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTetR-BCD2-Ana GvpC
Plasmid#153298PurposeExpresses wild-type gas vesicle protein C (GvpC) from Anabaena flos-aquaeDepositorInsertGas vesicle protein C
ExpressionBacterialPromoterpTetAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
D92_Ld_360170
Plasmid#135905PurposeExpression of Leishmania donovani ectodomain in mammalian cellsDepositorInserthypothetical protein, conserved
Tagsbiotinylation sequence and His tagExpressionMammalianAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM117: VEGFA array presgRNA
Plasmid#166869PurposeU6-driven expression of human VEGFA targeting array presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting array presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ChroME(F243Y)-mRuby2-ST
Plasmid#109127PurposeModified cation channelrhodopsin ChroME fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChroME(F243Y)-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only