We narrowed to 6,687 results for: tac
-
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable sinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-iCasp9-P2A-Crry-T2A-mCD59-E2A-Qa1 SCT-F2A-neo-AAVS1
Plasmid#205445Purposehuman AAVS1-targeting plasmid for expression of iCasp9, Crry, mouse CD59, and Qa1 SCTDepositorInsertiCasp9-Crry-mCD59-Qa1 SCT
UseTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-importinα
Plasmid#119679PurposeExpresses DsRed-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
UseTagsDsRedExpressionMammalianMutationContains amino acids 251-529PromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA0250-mCherry-2a-hM4D-nrxn1a rev
Plasmid#60544PurposeCo-expresses hM4Dnrxn and a red fluorescent label from a Cre-dependent virusDepositorInsertsUseAAV and Cre/LoxTags2xHAExpressionMutationPromoterCAGAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-hCD46-P2A-HLA-G SCT-T2A-hCD47-E2A-hCD59-F2A-neo-AAVS1
Plasmid#205443Purposehuman AAVS1-targeting plasmid for expression of iCasp9, HLA-E SCT, human and CD55DepositorInserthCD46-HLA-G SCT-hCD47-hCD59
UseTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-HSV TK-P2A-H2-Kb SCT-T2A-mCD47-E2A-mCD55-F2A-neo-AAVS1
Plasmid#205446Purposehuman AAVS1-targeting plasmid for expression of HSV TK, H2-Kb SCT, mouse CD47, and mouse CD55DepositorInsertHSV TK-H2-Kb SCT-mCD47-mCD55
UseTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162242)
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorInsertTRIM33 (TRIM33 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherTagsExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP
Plasmid#102935PurposeAn AAV vector that expresses rat NK1R-IRES-EGFP under the CMV-IE promoterDepositorInsertNK1R (Tacr1 Rat)
UseAAVTagsExpressionMammalianMutationPromoterCMV-IEAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorInsertCASP8 sgRNA (CASP8 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-iCasp9-P2A-HLA-E SCT-T2A-hCD55-E2A-neo-AAVS1
Plasmid#205444Purposehuman AAVS1-targeting plasmid for expression of human CD46, HLA-G SCT, CD47, and CD59DepositorInsertiCasp9-HLA-E SCT-hCD55
UseTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLAP-BUBR1-dKARD
Plasmid#114053Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorInsertBUBR1-dKARD (BUB1B Human)
UseTagsYFP-TEV-S- Human LAPExpressionMammalianMutationC2823A and G2826A (siRNA-resistance): AGATACTAGCT…PromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cntn6-AP-His
Plasmid#71944PurposeExpresses the extracellular region of the Contactin 6 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn6 (Cntn6 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROR2 gRNA (BRDN0001146490)
Plasmid#77940Purpose3rd generation lentiviral gRNA plasmid targeting human ROR2DepositorInsertROR2 (ROR2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-Zc3h12a 3’UTR
Plasmid#222662PurposeLuciferase reporter vector containing mouse Zc3h12a 3'UTRDepositorInsertZc3h12a 3'UTR (Zc3h12a Mouse)
UseLuciferaseTagsExpressionMammalianMutationPromoterPGKAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3_1-547 aa
Plasmid#222657PurposeMammalian expression vector to express 1-547 aa of Regnase-3 tagged with FLAG at N-termDepositorInsertZc3h12c 1-547 aa (Zc3h12c Mouse)
UseTagsFLAGExpressionMammalianMutationmutated histidine 548 to a stop codonPromoterCMVAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3_1-409 aa
Plasmid#222658PurposeMammalian expression vector to express 1-409 aa of Regnase-3 tagged with FLAG at N-termDepositorInsertZc3h12c 1-409 aa (Zc3h12c Mouse)
UseTagsFLAGExpressionMammalianMutationmutated proline 410 to a stop codonPromoterCMVAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3_1-244 aa
Plasmid#222659PurposeMammalian expression vector to express 1-244 aa of Regnase-3 tagged with FLAG at N-termDepositorInsertZc3h12c 1-244 aa (Zc3h12c Mouse)
UseTagsFLAGExpressionMammalianMutationmutated asparagine 245 to a stop codonPromoterCMVAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-Regnase-3 WT-T2A-copGFP
Plasmid#222660PurposeLentiviral vector to express mouse Regnase-3 WTDepositorInsertZc3h12c (Zc3h12c Mouse)
UseLentiviralTagsExpressionMammalianMutationmutated stop codon prior to a T2A peptidePromoterEF1αAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Regnase-1 D141N
Plasmid#222654PurposeMammalian expression vector to express mouse Regnase-1 D141N mutantDepositorInsertZc3h12a (Zc3h12a Mouse)
UseTagsExpressionMammalianMutationmutated aspartic acid 141 to asparagine to abroga…PromoterCMVAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-FLAG-HA-Regnase-3 D252N
Plasmid#222652PurposeFor in vitro transcription of mouse Zc3h12c D252N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12c (Zc3h12c Mouse)
UseIn vitro transcriptionTagsFLAG and HAExpressionMutationmutated aspartic acid 252 to asparagine to abroga…PromoterT7Available sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-ZsGreen-P2A-FLAG-HA-Regnase-1 WT
Plasmid#222649PurposeFor in vitro transcription of mouse Zc3h12a tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseIn vitro transcriptionTagsFLAG and HAExpressionMutationPromoterT7Available sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (GAPDH)
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA (GAPDH Human)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-hCD59-T2A-GFP
Plasmid#205460Purposelentiviral plasmid for expression of human CD59DepositorInserthCD59 (CD59 Human)
UseTagsExpressionMammalianMutationPromoterUBCAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-AP-His
Plasmid#71939PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn1 (Cntn1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn3 (Cntn3 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
actin CP alpha 2 beta 2
Plasmid#13452DepositorUseTagsExpressionBacterialMutationnonePromoterAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-Fc-His
Plasmid#72067PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn3 (Cntn3 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScalps-Puro-FLAG_HA-Regnase-1 D141N
Plasmid#222663PurposeLentiviral vector to express mouse Regnase-1 D141N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationmutated aspartic acid 141 to asparagine to abroga…PromoterSFFVAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pScalps-Puro-FLAG-HA-Regnase-3 D252N
Plasmid#222664PurposeLentiviral vector to express mouse Regnase-3 D252N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12c (Zc3h12c Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationmutated aspartic acid 252 to asparagine to abroga…PromoterSFFVAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-Regnase-3 D252N-T2A-copGFP
Plasmid#222661PurposeLentiviral vector to express mouse Regnase-3 D252NDepositorInsertZc3h12c (Zc3h12c Mouse)
UseLentiviralTagsExpressionMammalianMutationmutated aspartic acid 252 to asparagine to abroga…PromoterEF1αAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-ZsGreen-P2A-FLAG-HA-Regnase-1 D141N
Plasmid#222650PurposeFor in vitro transcription of mouse Zc3h12a D141N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseIn vitro transcriptionTagsFLAG and HAExpressionMutationmutated aspartic acid 141 to asparagine to abroga…PromoterT7Available sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA324
Plasmid#215953PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0[EnAs]; sgCD46_v4[EnAs]; DR_v1[EnAs]; sgCD47_v2[EnAs]; DR_v2[EnAs]; sgCD55_v4[EnAs];DR_v3[EnAs];sgCD81_v4[EnAs]}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS97splitRBP_S1dC2
Plasmid#183769PurposeExpresses SHIP1-delta-C2-Enzyme domain flanked by RBPDepositorInsertSHIP1deltaC2 (INPP5D Human)
UseTags6HIS, RBP (C-terminal) w/HRV3C cleavage site, and…ExpressionBacterialMutationSHIP1deltaC2 includes aa N393 to aa Q730 onlyPromoterT7lacAvailable sinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-Fc-His
Plasmid#72065PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn1 (Cntn1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-Fc-His
Plasmid#72066PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001146328)
Plasmid#77167Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
CLK1 gRNA (BRDN0001146454)
Plasmid#76232Purpose3rd generation lentiviral gRNA plasmid targeting human CLK1DepositorInsertCLK1 (CLK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-AP-His
Plasmid#71943PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn5.1 (Cntn5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-Fc-His
Plasmid#72069PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn5.1 (Cntn5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only