We narrowed to 16,142 results for: grn
-
Plasmid#73532PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AagRNA
Plasmid#121953PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b tracrRNA/crRNA duplex
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA1
Plasmid#138182Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA2
Plasmid#138183Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Construct 10 - U6p_40nt_stgRNA
Plasmid#81249PurposeExpresses 40nt stgRNADepositorInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PABPC1_sgRNA1
Plasmid#201608PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPABPC1 (PABPC1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_U6_AtPDS3_gRNA10
Plasmid#197965PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCfB3041(gRNA X-3)
Plasmid#73283PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e3 and e7
Plasmid#190689PurposesgRNAs targeting enhancer 3 and 7 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 3 and 7 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-ldhA
Plasmid#102288PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting ldhA.DepositorInsertldhA gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rpsL
Plasmid#89953PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rpsL.DepositorInsertrpsL gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_3
Plasmid#68809Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.DepositorInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_chr12_FAM19A2-up-gRNA-for
Plasmid#81221PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locusDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3046(gRNA XI-5)
Plasmid#73288PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Construct 1 - U6p_20nt1_WT_sgRNA
Plasmid#81245PurposeFor assaying self-targeting activity via Cas9DepositorInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#178107PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-53 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3044(gRNA XI-2)
Plasmid#73286PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only