We narrowed to 13,072 results for: BASE;
-
Plasmid#113946Purposemammalian expression plasmid for c-myc-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPRKCZ-C1-EGFP (C-PRKCZ-C1)
Plasmid#217759PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC1 domain (aa 123-193)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pORANGE GFP-Clta KI
Plasmid#131483PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiPromoter2x35SAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE CACNG8-GFP KI #2
Plasmid#131474PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: A408)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-Flag-Cul5
Plasmid#31984PurposeMammalian expression of Flag-tagged Cul5DepositorAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
Plasmid#109428PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.DepositorInsertmCherry T2A GFP
UseLentiviralMutationInserted 43 base pairs into mCherry to create rep…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Macro-Linker-eGFP
Plasmid#176067PurposeEGFP fused to the C-terminus of a Macrodomain & a hygromycin resistance cassetteDepositorInsertMacro
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
SNX29-PX (269-391)
Plasmid#119108PurposeBacterial expression of human phox homology (PX) domain, SNX29-PX (269-391)DepositorInsertSNX29-PX (269-391)
TagsGSTExpressionBacterialPromotertacAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST1374-GCN4-D10A
Plasmid#113022PurposeExpresses GCN4-D10A in mammalian cellsDepositorAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-CcVA
Plasmid#24588DepositorInsertGateway(TM) cassette
UseLentiviralTagsVAExpressionMammalianAvailable SinceAug. 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-FHA-Linker-eGFP
Plasmid#176065PurposeEGFP fused to the C-terminus of a FHA domain & a hygromycin resistance cassetteDepositorInsertFHA
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-WWE-Linker-eGFP
Plasmid#176072PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertWWE
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only