We narrowed to 7,581 results for: ef1a
-
Plasmid#244190PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF1aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF1 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4864 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF6a in MGEV
Plasmid#244189PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF6aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4207 TNFR2 NTEVp chain in PolyTX-mNeonGreen
Plasmid#244175PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, and NTEVp (75S) (TNFRSF1B Human, Synthetic)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-CHMP3(147)-HA
Plasmid#154177Purposeexpresses mouse CHMP3(147) in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 147PromoterEF1alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
289aa Met133, 138, 186Ileu ELL2
Plasmid#127272PurposeExpresses 289aa human ELL2 with Met133, 138, 186IleuDepositorInsertELL2 w Met to ILeus stopped at XbaI (ELL2 Human)
ExpressionMammalianMutationMet133, 138, 186 Ileu, cut with XbaI blunt fillinPromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIND21-puro_SOX10-3xFLAG
Plasmid#250322PurposeTetracycline-inducible expression of SOX10. rtTA (Tet-ON) is driven by the EF1alpha promoter.DepositorAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBA900
Plasmid#122237PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs2 incorporated at the 3' end of the sgRNA constant region.DepositorInsertsgRNA with cs2 at the 3' end of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300
Plasmid#191764PurposeExpression of EGFP fused to core p300 histone acetyltransferaseDepositorInsertFRB-EGFP-p300 core (EP300 Human)
TagsEGFP (N-terminal of p300 core) and FRB (N-termina…ExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DM
Plasmid#64880Purposelentiviral expression of human POLQ double mutant (in POL and HDL domains)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M and D2330A,Y2331APromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A-siRNAresHAUS6_IRES_Blast
Plasmid#182887PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (siRNA resistant version)DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralTagsEGFPExpressionBacterial and MammalianMutationsilet mutations in aa 197 - 203 to confer resista…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4802 VEGFR2 NTEVp chain (WT NTEVp) in PolyTX-mNeonGreen
Plasmid#244173PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): VEGFR2SS-3xFLAG-VEGFR2ECD-VEGFR2TMD-NTEVp(WT)DepositorInsertMESA NTEVp chain with human VEGFR2 SS, ECD and TMD, and NTEVp (WT) (KDR Human, Synthetic)
UseSynthetic BiologyTagsVEGFR2 signal peptide - 3xFLAGExpressionMammalianPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
BII-BCA-Prom-ASCL2
Plasmid#133394PurposePiggybac vector for heterologous promoter reporter assay of human ASCL2 promoterDepositorInsertdestabilized tdTomato-NLS and destabilized NLS-GFP
ExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free) drives expressi…Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV_iRFP_P2AT2A_mScarlet-I_Myl9
Plasmid#172474PurposeMammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.DepositorInsertsUseLentiviralTagsmScarlet-IExpressionMammalianPromoterEF1alpha (with UCOE) and none (same transcript as…Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-S1977P
Plasmid#64876Purposelentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationS1977P, mimicking the chaos1 mutationPromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
BII-ChBtW-dnTCF4-ires-GFP
Plasmid#133378PurposePiggybac vector for constitutive expressionDepositorInsertdnTCF4 (TCF4 Human)
Tags2x FlagExpressionMammalianMutationdeltaN31PromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAR010 Lenti pEF-dEnAsCas12a-NLS-3XHA-T2A-BSD
Plasmid#195543PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only