We narrowed to 13,072 results for: BASE;
-
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
JG1202: CAG-human dLbCpf1(D832A)-NLS-3xHA-P65
Plasmid#104566PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domainDepositorInsertdLbCpf1(D832A)-p65
Tags3x HA and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KZ801: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121814PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 C64Y
Plasmid#139326PurposePlasmid expressing a sgRNA to introduce BRCA1 C64Y using base editingDepositorInsertsgRNA to insert BRCA1 C64Y using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E638K
Plasmid#139327PurposePlasmid expressing a sgRNA to introduce BRCA1 E638K using base editingDepositorInsertsgRNA to insert BRCA1 E638K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
H2A-mTurquoise-RHOA-G14V-deltaCAAX
Plasmid#176097PurposeConstitutively active, nucelar localized RhoADepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
H2A-mTurquoise-RAC1-G12V-deltaCAAX
Plasmid#176095PurposeConstitutively active, nuclear localized Rac1DepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3A-eBE-Y132D
Plasmid#113429PurposeExpresses hA3A-eBE-Y132D in mammalian cellsDepositorInserthA3A-eBE-Y132D (APOBEC3A S. pyogenes and Bacteriophage PBS2, Human)
UseCRISPRExpressionMammalianMutationhAPOBEC3A_Y132DPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRD395
Plasmid#163102PurposeExpression of mCherry_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmCherry_H-NSdbd
ExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO101: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-Dnmt3a3L
Plasmid#121833PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLN193 (SSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105210PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 3 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyExpressionMammalianAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only