We narrowed to 19,343 results for: EGFP
-
Plasmid#89871PurposeEGFP reporter vector for iTango systemDepositorInserttetO-EGFP
ExpressionMammalianPromoterTetOAvailable sinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Str-KDEL_SBP-EGFP-GPI
Plasmid#65294Purposesynchronize trafficking of EGFP-GPI from the ER (RUSH system)DepositorInsertGPI anchor
TagsEGFP and IL-2 Signal Sequence and Streptavidin Bi…ExpressionMammalianPromoterCMVAvailable sinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-Golgi eGFP
Plasmid#79809PurposeTo express and target GFP into the Golgi apparatus using lentivirusesDepositorInsertGolgi eGFP (B4GALT1 Human)
UseLentiviralTagsFusion of the first 62 amino acids of the human b…ExpressionMammalianPromoterCMVAvailable sinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP‐RNASEH2A
Plasmid#108700PurposeFor expression of N-terminally eGFP-tagged human RNASEH2A in mammalian cellsDepositorAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GB-NES
Plasmid#61017PurposeddGFP B-NESDepositorInsertddGFP B
TagsHindIII site and NES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA-EGFP-ELYS-polyA
Plasmid#59746PurposeExpress EGFP-ELYS in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorInsertEGFP-ELYS
TagsEGFPExpressionMammalianPromoterCMV and T7Available sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLJM1-EGFP-GRAM-W
Plasmid#211704PurposeLentiviral expression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187W mutation (pLJM1-EGFP-GRAM1b G187W)DepositorInsertEGFP-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL3-U6-sgRNA-EGFP
Plasmid#107721PurposeFor expression of sgRNA from the U6 promoter with EGFP expression simultaneouslyDepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5-EGFP-Tau AP P301L
Plasmid#46906Purposeexpresses EGFP tagged Tau AP P301L in mammalian cellsDepositorInsertTau AP P301L (MAPT Human)
TagsEGFPExpressionMammalianMutationP301L AND all 14 S/P or T/P amino acid residues (…PromoterCMVAvailable sinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCS2-TAG
Plasmid#26772DepositorInsertTdTomato-2A-H2BGFP-SV40pA
ExpressionMammalianAvailable sinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV FLEX Synaptophysin GFP
Plasmid#137188PurposeCre-dependent expression of synaptophysin-GFPDepositorInsertSynaptophysin GFP (Syp Mouse)
UseAAVAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N-Drd1
Plasmid#104358PurposeExpresses mouse dopamine receptor subtype 1 with EGFP fused to the C-terminus of the receptor. Localizes to primary cilia.DepositorAvailable sinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5-EGFP-Tau E14 P301L
Plasmid#46909Purposeexpresses EGFP tagged Tau E14 P301L in mammalian cellsDepositorInsertTau E14 P301L (MAPT Human)
TagsEGFPExpressionMammalianMutationP301L AND all 14 S/P or T/P amino acid residues (…PromoterCMVAvailable sinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pg-HIF-1alpha-EGFP
Plasmid#87204PurposeC-terminally EGFP-tagged human HIF-1aDepositorAvailable sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLVX-EF1a-EGFP-RAB7A-IRES-Puromycin
Plasmid#133027PurposeExpresses EGFP-tagged late endosome markerDepositorInsertRAB7A (RAB7A Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterHuman elongation factor 1 alphaAvailable sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti Lifeact-EGFP BlastR
Plasmid#84383PurposeLentiviral expression of EGFP-tagged Lifeact with Blasticidin selection in cells including neuronsDepositorInsertLifeact
UseLentiviralTagsEGFPPromoterCMV immediate earlyAvailable sinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
InsRA-eGFP
Plasmid#79795PurposeInsulin receptor isoform A with a inter-domain eGFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable sinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-RAB5A-IRES-Puromycin
Plasmid#134858PurposeExpresses EGFP-tagged early endosome markerDepositorInsertRas-related protein 5A
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1aAvailable sinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP NFAT5 (no EGFP)
Plasmid#13627DepositorAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by