We narrowed to 13,582 results for: sequence
-
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits
-
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGGB006
Plasmid#48823PurposeProvides an ER signal sequence as GreenGate N-terminal tag module.DepositorInsertsignal sequence ER
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
p218 pCMV-CREM-L
Plasmid#8396DepositorInsertCREM-L
UseCre/LoxExpressionMammalianMutationmodified Cre, single LOX 511 siteAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSKB3.MPN314
Plasmid#11433DepositorInsertcell division protein
ExpressionBacterialAvailable SinceApril 10, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2/bat-CoV RaTG13 E C-V5-tag
Plasmid#179977PurposeMammalian expression vector for SARS-CoV-2 E or bat RaTG13 E, V5-tagged (SARS-CoV-2 E and RaTG13 E have the same amino acid sequence and codon optimized sequence).DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.1
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseMutationVariant 1 is chr10:128568698-A-G where the inform…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseMutationVariant 2 is chr10:128569418-T-C where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2 NSP7/bat-CoV RaTG13 C-V5-tag
Plasmid#179974PurposeMammalian expression vector for SARS-CoV-2 Nsp7 or bat RaTG13 Nsp7, V5-tagged (SARS-CoV-2 Nsp7 and RaTG13 Nsp7 have the same amino acid sequence and codon optimized sequence).DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eNme2C-CBE6b
Plasmid#215830PurposeExpress CBE6b (with eNme2-C variant) in mammalian cellsDepositorInsertCBE6b-eNme2C-2xUGI
ExpressionMammalianAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pG108 - K
Plasmid#178039PurposeBacteroides - Escherichia coli shuttle vector with TetQ and Kanamycin selection markersDepositorInsertKanamycin resistance
ExpressionBacterialMutationErmAM has been replaced with Kanamycin for select…Available SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
SBE4-Luc
Plasmid#16495PurposeLuciferase reporter containing four copies of the Smad binding siteDepositorInsertSmad binding element
UseLuciferaseTagsluciferaseExpressionMammalianAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMT-Bip-GFP:V5:KDEL
Plasmid#69917PurposeAn endoplasmic reticulum (ER) marker used to visulaize the ER structure in Drosophilia S2 cells.DepositorInsertGFP
TagsDrosophila BiP signal sequence, KDEL ER targeting…ExpressionInsectPromoterpMTAvailable SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
T777T
Plasmid#113082PurposeEnhanced RNAi vektor for C. elegans. Contains two T7 polymerase termination sequences adjacent to the T7 promoter sites and a lacZ coding sequence.DepositorTypeEmpty backboneUseRNAiExpressionBacterialAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET259-pUC57 24xMS2V6
Plasmid#104391PurposeMS2V6 cloningDepositorInsert24xMS2V6
ExpressionBacterialMutationAll Loops are U-variants, interspaced by 50 nucle…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
mNeonGreen-KDEL
Plasmid#226568PurposeEncodes mNeonGreen with KDEL ER lumenal target sequenceDepositorInsertKDEL (ER lumenal target sequence)
TagsmNeonGreenExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p212 pCMV-EGFP/RFP
Plasmid#8389PurposeGene-switch Cre reporter plasmid with floxed EGFP gene upstream of RFP.DepositorInsertfloxed EGFP
UseCre/LoxExpressionMammalianAvailable SinceMay 31, 2006AvailabilityAcademic Institutions and Nonprofits only