We narrowed to 15,275 results for: grn
-
Plasmid#192893PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFOXL2 C-term sgRNA (FOXL2 Synthetic)
UseCRISPRPromoterU6Available sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2a/Cre
Plasmid#89644PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-mCh-GFPi
Plasmid#21905DepositorInsertGFPi
UseLentiviral and RNAiExpressionMammalianAvailable sinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV P2Gm +SwaI
Plasmid#22699DepositorInsertmiR30
UseRNAi and RetroviralExpressionMammalianAvailable sinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available sinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available sinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_1
Plasmid#138324PurposeExpress guide RNA 2 for mouse MycDepositorAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-Pten-2
Plasmid#162552PurposesgRNA targeting PtenDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting Pten (Pten Mouse)
ExpressionMammalianMutationNonePromoterU6Available sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
plenti_DCLK1
Plasmid#163625PurposeExpresses DCLK1DepositorAvailable sinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD3_3
Plasmid#36373DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEE531
Plasmid#149290PurposeT-DNA encoding TRV2 with spacer multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Spacer_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE491
Plasmid#149292PurposeT-DNA encoding TRV2 with tRNA multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_tRNA_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOCT4-gRNAs-1-5-PGK-puro (POU5F1 )
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LTR5HS S. pyogenes scaffold CARGO array
Plasmid#191316PurposeContains an array of guide RNAs targeting LTR5Hs elementsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertArray of guide RNAs
UseCRISPRTagsmCherryExpressionMammalianAvailable sinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCas-CmR(+)
Plasmid#113633PurposeChloramphenicol resistant derivative of pCas plasmidDepositorInsertChloramphenicol resistance gene
UseCRISPRPromoterPcatAvailable sinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCPCbLCV.007
Plasmid#22785DepositorPublicationInsertA DNA (with MCS)+
UseRNAi; Arabidopsis vigs vectorAvailable sinceJuly 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available sinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LRG2.1_Neo
Plasmid#125593PurposeLentiviral expression of sgRNA with GFP and neomycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by