176,063 results
-
Plasmid#86230PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using puromycine selection. Auxin-inducible degron system.DepositorInsertAID[71-114]-eGFP
UseMouse TargetingExpressionMammalianAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_SPOP_WT
Plasmid#81856PurposeGateway Donor vector containing SPOP ,part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7-VP3SA11
Plasmid#89164PurposeExpress Rotavirus SA11 VP3 in mammalian cellsDepositorInsertRotavirus SA11 VP3
ExpressionMammalianPromoterT7 promotorAvailable sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACYC-Skp-GroEL/ES
Plasmid#83922PurposeCo-expresses cytoplasmic copies of the Skp and Gro EL/ES protein folding chaperones.DepositorInsertsSkp
Gro EL/ES
ExpressionBacterialPromoterT7Available sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLuc
Plasmid#83281Purposerecombinant AAV vector packaging single-stranded Firefly Luciferase under the CAG promoter (includes WPRE element)DepositorInsertFirefly Luciferase
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p415 TEF roGFP2‐Tsa2ΔCR
Plasmid#83238PurposeThe genetically encoded fluorescent H2O2 sensor roGFP2-Tsa2ΔCR cloned in the yeast p415 vector under the control of a TEF promoter. For cytosolic expression.DepositorInsertroGFP2-Tsa2dCr
TagsroGFP2 fusion with Tsa2dCrExpressionYeastPromoterTEFAvailable sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPaint-TagGFP2-PuroR
Plasmid#80970PurposeCRISPaint gene taggingDepositorInsertTagGFP2
UseGene taggingPromoternoneAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTriEx-mCherry-Zdk1
Plasmid#81057Purposemammalian expression of Zdk1DepositorInsertZdk1
Tags6x His tag, FLAG, and mCherryExpressionBacterial, Insect, and Mamm…Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIκBα-miRFP703
Plasmid#80005PurposeIκBα fused with near-infrared fluorescent protein miRFP703 (IκBα reporter)DepositorAvailable sinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3_erGAP3
Plasmid#78118PurposeLow affinity fluorescent calcium indicator of the GAP (GFP-Aequorin Protein) family targeted to the endoplasmic reticulumDepositorInserterGAP3
TagsKDEL and calreticulin signal peptideExpressionMammalianMutationS175G, D180Y, I167V and L15Q in GFP moiety and D…PromoterCMVAvailable sinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP_TRPM8
Plasmid#64879PurposeExpresses Ion Channel TRPM8 fused to eGFP in mammalian cellsDepositorInsertTransient receptor potential cation channel subfamily M member 8 (Trpm8 Rat)
TagseGFPAvailable sinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p323-L10A-PATagRFP
Plasmid#74172PurposeFluorescent reporter for single ribosome trackingDepositorAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NLS-mCherry-NES reporter (pDN160)
Plasmid#72660PurposeNLS-mCherry-NES 17 reporter for light-inducible nuclear export block with pDN157 and pDN158DepositorInsertNLS-mCherry-NES
ExpressionMammalianPromoterCMVAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
TagsN-terminal His6 tagExpressionBacterialAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET28a-MSP1D1deltaH4-H6
Plasmid#71717PurposeMembrane scaffold protein (MSP), helix 4 to 6 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable sinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT040
Plasmid#67640PurposeURA3 vector for cloning guide sequences using BclI-SwaI sites into guide RNA expression cassetteDepositorInsertsingle guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52Available sinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5FRT-EF-Pdgfrbeta-EGFPN
Plasmid#66790PurposeExpression of murine PDGFRbeta tagged with GFP under the control of EF1a promoterDepositorAvailable sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Str-KDEL_neomycin
Plasmid#65306PurposeLuminal ER hook only (RUSH system)DepositorInsertStreptavidin fused to a signal sequence at 5' end and to a KDEL motif at 3' end
TagsKDEL motif and Signal SequenceExpressionMammalianPromoterCMVAvailable sinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by