We narrowed to 14,508 results for: SHR
-
Plasmid#127907PurposeWT Cas9 Vector targeting the 3' end of the human HP1a geneDepositorInsertgRNA for Human 3' HP1a
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCB619
Plasmid#171011PurposeCRISPR sgRNA vector (puro-BFP with BstXI/BlpI digest sites).DepositorInsertU6:sgRNA_Puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA-MS2-U6
Plasmid#171694PurposeTo construct expression vector for tBE-V5-mA3DepositorInsertsgRNA scaffold-MS2-U6
UseCRISPRExpressionMammalianAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E1.3 gRNA
Plasmid#90880Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E10.3 gRNA
Plasmid#90685Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDF0584 huDisCas7-11 S1006-GGGS-D1221 U6-NT guide
Plasmid#186993PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, non-targeting crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgROSA26
Plasmid#231562PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human ROSA26 locus (Puromycin selection marker)DepositorInsertsgROSA26
UseCRISPR and LentiviralExpressionMammalianPromoterU6, EF-1aAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-sh5Resistant
Plasmid#225448PurposeExpress mEGFP-fusion protein of FXR1 isoform a with shRNA5-resistant silent mutationDepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Dnmt3b-R
Plasmid#122333PurposeExpresses sgRNA targeting mouse Dnmt3b and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Dnmt3b
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Pclo KI
Plasmid#139657PurposeEndogenous tagging of Piccolo: N-terminal (amino acid position: G2)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pW267-lenti-spsgRNA-hsCDH1-sg1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170816PurposeLentiviral vector to co-express a human CDH1 spsgRNA (sg1-Cdh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL3241 PB-AtoBpegRNA-mCherry
Plasmid#226666PurposePiggyBac cargo vector encoding A to B pegRNA marked with mCherryDepositorInsertAtoB pegRNA
UseCRISPRExpressionMammalianAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A6.5 gRNA
Plasmid#90569Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMGIB-3xFLAG-pontin
Plasmid#53608PurposeRetroviral expression of human pontinDepositorInsertpontin (RUVBL1 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationpontin CDS mutated to confer resistance to shRNA.…PromoterLTRAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2hyg-Ptgs1
Plasmid#170299PurposeA knock-out vector for the mouse Ptgs1DepositorInsertA gRNA targeting the mouse Ptgs1 gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only