We narrowed to 11,731 results for: Hal
-
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVTagsExpressionMutationPromoterTREAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSK234
Plasmid#131149Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mKate2DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionYeastMutationPromoterAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK260
Plasmid#129252Purposedual yTRAP, NM fusion to aTF1 reporting on [PSI+] state with mKate2 reporterDepositorInsertSup35 NM yTRAP sensor reporting on mKate2
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK247
Plasmid#131148Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mNeonGreenDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterpSUP35, min pCYC1Available sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK226
Plasmid#129268Purposedual yTRAP, RNQ1 fusion to aTF2 reporting on [RNQ+] state with mNeonGreen reporterDepositorInsertRnq1
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVTagsExpressionMammalianMutationPromoterhSyn1Available sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP
Plasmid#117383PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFPDepositorHas ServiceAAV1InsertEYFP
UseAAVTagsExpressionMammalianMutationPromoterTREAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MuHKII-pGFPN3
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
UseTagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …PromoterAvailable sinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(Q147L)_g4+g10+g18
Plasmid#172316PurposeCRISPR dCas9 directly fused to a variant of bacterial DNA methyltransferase MQ1 to target CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(Q147L)_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNH11 (pmyo-2::Arch(D95N)::2xMycTag)
Plasmid#130275PurposeExpresses the voltage sensor Arch(D95N) in the pharynx of C. elegans.DepositorInsertArch(D95N)
UseTags2x Myc-tagExpressionWormMutationPromoterAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pNH13 (pmyo-2::QuasAr::mOrange)
Plasmid#130273PurposeExpresses the eFRET-based voltage sensor QuasAr::mOrange in the pharynx of C. elegans.DepositorInsertQuasAr::mOrange
UseTagsmOrangeExpressionWormMutationPromoterAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3
Plasmid#214922Purposeexpression vector control - contitutive expression of mClover3 aloneDepositorInsertmClover3
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAN200
Plasmid#129203PurposeyTRAP sensor of [PSI+], detects aggregation of Sup35DepositorInsertSup35NM (SUP35 Budding Yeast)
UseSynthetic BiologyTagsExpressionYeastMutationN terminal and middle domainsPromoterSUP35Available sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPExpressionMutationD387APromoterUASAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
UseTagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…PromoterAvailable sinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiTagsExpressionMutationPromoterH1Available sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATG-1929
Plasmid#108712PurposeCBR2opt in pF4Ag expression vector with T7 and CMV promoterDepositorInsertCBR2opt
UseTagsExpressionBacterial and MammalianMutationPromega used directed evolution to create CBR (Cl…PromoterT7, CMVAvailable sinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 H2B-GFP-uvr8at(2x)
Plasmid#44970DepositorUseTagsinternal GFPExpressionMammalianMutationtandem repeat of UVR8 (both have Methionine 1 del…PromoterpCMV IEAvailable sinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only