We narrowed to 21,477 results for: SPR
-
Plasmid#220211PurposeMammalian expression of wild type TEX264 fused at C-terminus to GFPDepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SOX17-3'gRNA
Plasmid#210465PurposegRNA targeting SOX17 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertSOX17 (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS_375
Plasmid#182132Purposeexpresses retron RNA, ec.86 Reverse Transcriptase, CspRecT SSAP, and mutL* to create a specific rifampicin resistance mutation while inhibiting MMRDepositorInsertsretron RNA
ec.86 RT
CspRecT
Mutationincorporated rifampicin-resistance-conferring don…Available SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-PJ23119-PplpT-sfGFP-TrrfB-BsaI-Scaf-L2
Plasmid#196250PurposePlasmid for cloning of a CRISPR-Cas9 guide RNA gene under promoter PJ23119DepositorInsertattL1-GlpT-scGFP-attL2
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-NRCH-PE2-BSD
Plasmid#191101PurposeLentiviral expression plasmid of NRCH-PE prime editor with P2A-BSD markerDepositorInsertNRCH-PE2-BSD
UseCRISPR and LentiviralTagsSV40 NLSExpressionMammalianPromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-NLS-dHgm4Cas13b-3xGFP-NLS
Plasmid#191368PurposeOverexpression of NLS-NLS-dHgm4Cas13b-3xGFP-NLS in human cellsDepositorInsertNLS-NLS-dHgm4Cas13b-3xGFP-NLS
Tags3xGFPExpressionMammalianAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-NLS-dPba3Cas13b-3xGFP-NLS
Plasmid#191369PurposeOverexpression of NLS-NLS-dPba3Cas13b-3xGFP-NLS in human cellsDepositorInsertNLS-NLS-dPba3Cas13b-3xGFP-NLS
Tags3xGFPExpressionMammalianAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-177 pUC19-CLTA-N-mCherry
Plasmid#186128Purposeknockin of mCherry to CLTA targetDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1a#1/Cre
Plasmid#173571PurposeExpresses a Arid1a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1a (Arid1a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHS0667 KraIscB-1 non-coding locus in pCOLADuet-1
Plasmid#176537PurposeNon-protein coding locus components from KraIscB-1DepositorInsertnon-coding locus components from KraIscB-1 locus
ExpressionBacterialAvailable SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-SasgRNA scaffold-CMV-nSaCas9
Plasmid#171695PurposeExpresses nSaCas9 in mammalian cellsDepositorInsertsgRNA scaffold-nSaCas9-NLS
UseCRISPRExpressionMammalianMutationD10APromoterU6 and CMVAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_non-targeting
Plasmid#140109PurposeCRISPR-Cas9 library validation (negative control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
PHY98-LMNA 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#164046PurposeCRISPR donor plasmid to insert TriTag (mTagBFP) into the N-terminus of human LMNA geneDepositorInsertmTagBFG-TriTag
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mU6-Luc2GO-PGK-Neo
Plasmid#136905PurposeLentivirus for base editing activatable Luciferase2 expression in mammalian cells. All in one vector with sgLuc2GO.DepositorInsertLuc2CyGo
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CADPS KI
Plasmid#131482PurposeEndogenous tagging of CAPS1: N-terminal (amino acid position: S39)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-CUL4A WT-P2A-Puro
Plasmid#124304PurposeLentiviral vector for expression of wild-type CUL4A-P2A-Puro casette from a CMV promoterDepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only