We narrowed to 16,217 results for: grn
-
Plasmid#171525PurposePlasmid contains the Cas12k gRNA and transposon donor cassetteDepositorInsertCas12k gRNA, transposon donor cassette
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNC-Y
Plasmid#238998PurposeNode C carrying sgRNA-1 that can be used for the assembly of pEND-11Y or pEND-ZYDepositorInsertsgRNA-1 downstream of a weak constitutive promoter and a binding site for sgRNA-2
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ107-2x
Plasmid#208812PurposeExpresses SoxS activation domainand gRNA targeting two copies of 107 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 107-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ105
Plasmid#208859PurposeExpresses SoxS activation domain and gRNA targeting 105 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 105
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ106-2x
Plasmid#208860PurposeExpresses SoxS activation domain and gRNA targeting two copies of 106 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 106-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8270 LentiCRISPR v2 hygro sgSIGIRR-3
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8921
Plasmid#220903PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8932
Plasmid#220906PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PG-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC2
Plasmid#191857PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: ATCATG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC6
Plasmid#191861PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CCTAGT) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC5
Plasmid#191860PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: AGTCTA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC4
Plasmid#191859PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: GTATGA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC3
Plasmid#191858PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: GCATGG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC1
Plasmid#191856PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CTTTCA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPB
Plasmid#164989PurposeExpression of gRNA targeting HLA-DPB locus, including DPB1*01:01:01DepositorInsertgRNA against HLA-DPB1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQB
Plasmid#164991PurposeExpression of gRNA targeting HLA-DQB locus, including DQB1*05:01:01DepositorInsertgRNA against HLA-DQB1*05:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DRB
Plasmid#164992PurposeExpression of gRNA targeting HLA-DRB locus, including DRB1*01:02:01DepositorInsertgRNA against HLA-DRB1*01:02:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only