We narrowed to 10,282 results for: EPO;
-
Plasmid#218205PurposeZebrafish -2.1prox1a enhancer reporter in the lymphatic valve from 3 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a
UseZebrafish expressionAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(H66)
Plasmid#63558PurposeExpression of the Azure (blue) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(H66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT3_mCherry2-NLS-PEST_Puro
Plasmid#213771PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-NPC1(D786N)-FLAG
Plasmid#164975PurposeLentiviral vector for NPC1 expression in mammalian cellsDepositorInsertNPC1 (NPC1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationD786N, insertion L aa15 (please see depositor co…PromoterEF1aAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG26
Plasmid#226743PurposeExpresses a reporter for a mitochondrial intermembrane space proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7a-5p
Plasmid#103146PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7a-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-E-cadherin promoter
Plasmid#61798PurposeLuciferase reporter containing the mouse E-cadherin promoterDepositorInsert-178/+92 fragment of the mouse Cdh1 promoter (Cdh1 Mouse)
UseLuciferaseExpressionMammalianAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSYN-bArrestin2-TevC-P2A-TdTomato-WPRE-bGHpA
Plasmid#89873Purposeexpresses iTango bArrestin2-TevC component and TdTomato bicistronically for AAV productionDepositorInsertbArrestin2-TevC-P2A-TdTomato
UseAAVTagsTdTomatoExpressionMammalianMutationR173H in TdTomato (Please see depositor comments …PromoterHuman synapsinAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Lifeact- mScarlet-HA (JDW 1247)
Plasmid#224538PurposeA Gateway compatible middle entry clone containing Lifeact-mScarlet-I (far red f-actin reporter)DepositorInsertLifeact-mScarlet-HA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-GCaMP6s-WPRE-pGHpA
Plasmid#67526Purpose"Fluorescent reporter for calcium imaging"DepositorInsertGCaMP6s
UseAAVTags6xHis, T7 tag, and Xpress epitopeExpressionMammalianPromoterEF1aAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEntr1a-mcherry-FKBP-TIAM1(DHPH)
Plasmid#176135PurposeHeterodimerization with FRB (rapamycin), Rac1 activationDepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
mKate2-P2A-APEX2-2xFYVE_hrs
Plasmid#67663PurposeMammalian expression vector driving APEX2-2xFYVE (2xMouse FYVE domain from HRS, [marks PI3P] fused to EM peroxidase marker). Also contains bicistronially expressed cytoplasmic red reporter.DepositorInsertmKate2-P2A-APEX2-2xFYVE
ExpressionMammalianPromoterCMVAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-Ccnd2PromoterRegion1(1.2kb)
Plasmid#228058Purpose1.2 kb from mouse Ccnd2 promoter in front of firefly luciferase reporterDepositorInsertCcnd2 promoter (Ccnd2 Mouse)
UseLuciferaseAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash6
Plasmid#74134PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 410 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-mCherry(LaM8) PAGER(TF)
Plasmid#229999PurposeExpresses anti-mCherry PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaM8-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4_NFAT-RE-CMVmin-BC0524-luc2
Plasmid#227139PurposeBarcoded assay, Ca2+ sensor; barcode BC0524DepositorInsert6x clustered NFAT element linked to CMV minimal promoter driving barcode 0524 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash1
Plasmid#74129PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 40 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only