59,428 results
-
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14566
Plasmid#239272PurposeExpresses TRF1-PYL1 for recruiting RNA to the telomere via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14806
Plasmid#239273PurposeExpresses TRF1-PYL1 for recruiting RNA to the nuclear stress body via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10539
Plasmid#239270PurposeExpresses PYL1-DDX6 for recruiting RNA to the p-body via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-IKZF2
Plasmid#207216Purposedoxycycline-inducible expression of Human IKZF2 in mammalian cellsDepositorInsertpFUW-TetO-IKZF2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(Δ41-54/Δ103-130)
Plasmid#242236PurposeExpresses alpha synuclein (missing exon 3 and 5, residues 41-54 and 103-130) in bacteriaDepositorInsertasyn(Δ41-54/Δ103-130)
TagsnoneExpressionBacterialMutationdeleted amino acids 41-54 and 103-130Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(Δ103-130)
Plasmid#242235PurposeExpresses alpha synuclein (missing exon 5, residues 103-130) in bacteriaDepositorInsertasyn(Δ103-130)
TagsnoneExpressionBacterialMutationdeletion of residues 103-130Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(Δ41-54)
Plasmid#242234PurposeExpresses alpha synuclein (missing exon 3, residues 41-54) in bacteriaDepositorInsertasyn(Δ41-54)
TagsnoneExpressionBacterialMutationdeleted amino acids 41-54Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-KS
Plasmid#237644PurposeFor overexpression of mEGFP-NUP98-DDX10-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-MTS-TFAM-V5
Plasmid#200813Purposeexpresses MTS-TFAM in mammalian cellsDepositorAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-RARG
Plasmid#222570PurposePiggyBac transposon plasmid for doxycycline inducible expression of RARGDepositorInsertRARG (RARG Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP670-C1-Nir1-LNS2
Plasmid#220085Purposehigh affinity PA biosensor with far-red fluorophoreDepositorInsertPITPNM3 (PITPNM3 Human)
TagsiRFP670-GGSGGMExpressionMammalianMutationamino acids 613-897PromoterCMVAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
SGLT2(GFP)-MAP17(nb)
Plasmid#216211Purposefor expression of human GFP-tagged SGLT2-MAP17 nanobody complex in BacMam systemDepositorTagsGFPExpressionMammalianAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsRoquin2_AE
Plasmid#148614PurposeMammalian Expression of HsRoquin2DepositorInsertHsRoquin2 (RC3H2 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC29A2_STOP
Plasmid#161305PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC29A2 (SLC29A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIG-830_HA-GD2-28z_CAR_tNGFR_Retroviral
Plasmid#207507PurposeThis plasmid can be used to generate retrovirus.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_WT USP7
Plasmid#131242PurposeMammalian expression of N-terminally Myc-tagged USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianPromoterCMV enhancer + CMV promoterAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-SNAP-V5-polyA-Puro HR
Plasmid#229680PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with SNAP tag and a V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only