We narrowed to 7,347 results for: alp;
-
Plasmid#229696PurposeTransient expression of GFP-alpha-cateninV- in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsEGFPExpressionMammalianMutationL344PPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2-ΔSAMD
Plasmid#226507PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD gene deleted SAM domainDepositorInsertDGKD (DGKD Human)
UseTagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCMVAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-SpCas9D10A nickase
Plasmid#216736PurposeExpresses SpCas9-D10A nickase from a nEF promoter. For AAV packaging. Derived from pAAV-nEF-SpCas9 (Addgene #87115)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRTagsExpressionMammalianMutationD10APromoterEF-1-alpha coreAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUG36-NES-EGFP-cPHx3
Plasmid#183668PurposePtdIns(3,4)P2 biosensor for expression in yeastDepositorInsertPLEKHA1 (PLEKHA1 Frog, Human)
UseTagsX. laevis map2k1.L(32-44)-EGFPExpressionYeastMutationAmino acids 169-329 (tandem trimer)PromoterMET25Available sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUG34-NES-EGFP-cPHx3
Plasmid#183669PurposePtdIns(3,4)P2 biosensor for expression in yeastDepositorInsertPLEKHA1 (PLEKHA1 Frog, Human)
UseTagsX. laevis map2k1.L(32-44)-EGFPExpressionYeastMutationAmino acids 169-329 (tandem trimer)PromoterMET25Available sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
NES-mCherry-PH-BTKx1
Plasmid#183653PurposePtdIns(3,4,5)P3 biosensorDepositorInsertBTK (BTK Frog, Human)
UseTagsX. laevis map2k1.L(32-44)-mCherryExpressionMammalianMutationAmino acids 2-170PromoterCMVAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/N847A Δ450-572-pBabe-Puro
Plasmid#25936DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…PromoterAvailable sinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple (bidirectional) GasS
Plasmid#196055PurposeEncodes a G alpha subunit (GNAS2) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorInsertsUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai1
Plasmid#196048PurposeEncodes a G alpha subunit (GNAl1) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CAMK2A
Plasmid#23408DepositorInsertCAMK2A (CAMK2A Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
Capping Protein
Plasmid#89950PurposeF-actin-capping proteins bind in a Ca2+-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends.DepositorInsertsUseTags6*HisExpressionBacterialMutationV222IPromoterAvailable sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HIF1A_WT
Plasmid#82129PurposeGateway Donor vector containing HIF1A , part of the Target Accelerator Plasmid Collection.DepositorInsertHIF1A (HIF1A Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PIK3CA
Plasmid#23466DepositorInsertPIK3CA (PIK3CA Human)
UseGateway donor vectorTagsExpressionMutationA1035VPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ERO1L_WT
Plasmid#81797PurposeGateway Donor vector containing ERO1L , part of the Target Accelerator Plasmid Collection.DepositorInsertERO1L (ERO1A Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
KRD9_HBA1(HBA1reg-HBB)
Plasmid#232402PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank HBA1 cassette. HAs are ~400bp each.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KRD2_HBA1(HBA1reg-UbC-GFP)
Plasmid#232401PurposeAAV production plasmid for HBA1 WGR vector from Fig. 1 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBA1 UTRs flank UbC-GFP cassette; GFP is followed by BGH polyA. HAs are ~400bp each.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorInsertKcnma1 (Kcnma1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Slo1 K+ channel [L6/60R-1]
Plasmid#206694PurposeMammalian Expression Plasmid of anti-Slo1 K+ channel (Mouse). Derived from hybridoma L6/60-1.DepositorInsertanti-Slo1 K+ channel (Mus musculus) recombinant Mouse monoclonal antibody (Kcnma1 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai3
Plasmid#196050PurposeEncodes a G alpha subunit (GNAl3) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga12
Plasmid#196061PurposeEncodes a G alpha subunit (GNA12) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga13
Plasmid#196062PurposeEncodes a G alpha subunit (GNA13) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-Fusion + CBP TAZ1(340-439)
Plasmid#173762PurposeBacterial coexpression of CBP TAZ1 and CITED2/Hif1a activation domain constructsDepositorUseTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-FusionL21A + CBP TAZ1(340-439)
Plasmid#173763PurposeBacterial Coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorUseTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIsGB1-FusionL63A + CBP TAZ1(340-439)
Plasmid#173764PurposeBacterial coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorUseTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai2
Plasmid#196049PurposeEncodes a G alpha subunit (GNAl2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga11
Plasmid#196059PurposeEncodes a G alpha subunit (GNA11) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga15
Plasmid#196060PurposeEncodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2975
Plasmid#144451PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertNAT10 (NAT10 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2510
Plasmid#144032PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertNAT10 (NAT10 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1499
Plasmid#29247PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle28 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1498
Plasmid#29246PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle27 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1500
Plasmid#29248PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle29 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorTagsExpressionMammalianMutationPromoterTRE+CMVmin promoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luc-ZsGreen
Plasmid#39196DepositorInsertsFirefly Luciferase Luc2P
ZsGreen
UseLentiviralTagsExpressionMammalianMutationPromoterEF1-alpha and EF1-alphaAvailable sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luciferase
Plasmid#21375Purposeself-inactivating 3rd generation lentiviral plasmid for co-expression of your gene of interest and LuciferaseDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 19, 2009AvailabilityAcademic Institutions and Nonprofits only -
Gaq-LSS-SGFP2
Plasmid#112951PurposeGalphaq tagged with LSS-SGFP2DepositorInsertGalphaq
UseTagsLSS-SGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-C1-p85beta
Plasmid#1408DepositorInsertPI3K regulatory subunit p85beta (Pik3r2 Mouse)
UseTagseYFPExpressionMammalianMutationPromoterAvailable sinceJune 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKI-v2
Plasmid#45066PurposeExpression of PKI (PKA inhibitor)DepositorInsertcAMP-dependent protein kinase inhibitor alpha
UseTagsExpressionMammalianMutationPromoterRSVAvailable sinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T3-p85beta
Plasmid#1406DepositorInsertPI3K regulatory subunit p85beta (Pik3r2 Mouse)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKImut-v2
Plasmid#45067PurposeExpression of intactive PKI (PKA inhibitor) mutantDepositorInsertcAMP-dependent protein kinase inhibitor alpha
UseTagsExpressionMammalianMutationchanged Arg 20 & 21 to GlycinesPromoterRSVAvailable sinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHCA/GAL4(848).ER
Plasmid#108215PurposeYeast expression vector for fusion of Gal4 AA 1-848 to hormone binding domain of estrogen receptor aDepositorInsertGal4-ERalpha HBD
UseTagsExpressionYeastMutationERalpha HBD has G400V mutationPromoterADH0Available sinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorInsertPPM1A (PPM1A Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTUB:FLuc
Plasmid#114578PurposeConstitutive expression of firefly luciferase in T. gondii using the alpha tubulin promoter; floxed pyrimethamine selectable marker; UPRT locus flanking sequence to direct integrationDepositorInsertFirefly Luciferase
UseCre/Lox and LuciferaseTagsExpressionMutationPromoteralpha tubulin T. gondiiAvailable sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIII CKBs CRISPR with guides at 1-2 and 2-3
Plasmid#238525PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha3DepositorInsertAtCK2alpha3 (AT2G23080 Mustard Weed)
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLII-CRISPR for CKA4
Plasmid#238521PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha4DepositorInsertAtCK2alpha4 (AT2G23070 Mustard Weed)
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKPY115
Plasmid#72669PurposeEncodes Thr251Gly-EcPheRS Under Arabinose-Inducible (PBAD) ControlDepositorInsertThr251Gly-EcPheRS
UseTagsExpressionBacterialMutationThr251Gly in Alpha SubunitPromoterPBADAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PGK_Prkaa1
Plasmid#204356PurposeLentiviral plasmid, Expresses Prkaa1 under the control of the PGK promoterDepositorInsertAMP-activated protein kinase alpha 1 (Prkaa1 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only