We narrowed to 71,523 results for: nin
-
Plasmid#72611PurposeFor mammalian expression of an N-terminally triple FLAG-tagged and C-terminally triple AU1-tagged full length human GATA6 with triple alanine mutations on aminoacids#33,#34 and #37DepositorInsertGATA binding protein 6 (GATA6 Human)
UseRetroviralTags3XAU1 and 3XFLAGExpressionMammalianMutationchanged serine33, threonine34 and serine37 to ala…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucA
Plasmid#174047PurposeExpresses mALG8 (ITYTWTRL) antigen as a fusion to luciferase and Cre recombinaseDepositorInsertLucA
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationALG8 alanine 506 to threoninePromoterHuman Ubiquitin CAvailabilityAcademic Institutions and Nonprofits only -
FLAG-JAK1
Plasmid#174572PurposeHuman FLAG-tagged JAK1 expression (N-term. tag) (CMV prom.)DepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA
Plasmid#160141PurposeCre- dependent expression of Sun1GFP for nuclei isolationDepositorInsertSun1-GFP (Sun1 Mouse)
UseAAVTagsGFPExpressionMammalianMutationN-truncated: removed amino acids 1-207, retained …PromoterEf1aAvailable SinceMarch 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav1.2 Ca2+ channel [L57/23R]
Plasmid#177484PurposeMammalian Expression Plasmid of anti-Cav1.2 Ca2+ channel (Rabbit). Derived from hybridoma L57/23.DepositorInsertanti-Cav1.2 Ca2+ channel (Oryctolagus cuniculus) recombinant mouse monoclonal antibody (CACNA1C Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-p300-P2A-PuroR
Plasmid#83889PurposeLentiviral Sp dCas9-p300-P2A-PuroRDepositorInsertsS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Synthetic, Human)
pac from Streptomyces alboniger
UseCRISPR and LentiviralTagsFlag and nucleoplasmin NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEFSAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#9 in pTwist-CMV backbone
Plasmid#216153PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells (brighter than #7). It uses a single intron. [Code 'B11']. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
HNF1B_pLX307
Plasmid#98342PurposeLentiviral expression of HNF1BDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_Cas9-blast_GFP
Plasmid#162074Purpose3rd generation lentivirus transfer vector for Cre-removable Cas9, GFP reporter, and blast resistanceDepositorInsertsCas9-2a-blasticidin S deaminase
EGFP
UseCRISPR, Cre/Lox, and LentiviralExpressionMammalianMutationcodon-optimized for expression in M. musculusPromoterEF1a and sv40Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
HSPA8_pLX307
Plasmid#98343PurposeLentiviral expression of HSPA8DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
MED12_pLX307
Plasmid#98350PurposeLentiviral expression of MED12DepositorInsertMED12 (MED12 Human)
UseLentiviralTagsV5ExpressionMammalianMutationR1392QPromoterE1FaAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Click editor (CE1) mRNA expression vector - T7-5'UTR-PCV2-nCas9-EcKlenow-3'UTR-polyA (CJT472)
Plasmid#217808PurposeExpression vector for mRNA production of the click editor construct (CE1; PCV2-nCas9-EcKlenow)DepositorInsert5'UTR-PCV2-XTEN-nSpCas9-BPNLS-EcKlenow(exo-)-BPNLS-3'UTR
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterT7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#10 in pTwist-CMV backbone
Plasmid#216154PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Leaky but very sensitive to mild TDP-43 loss of function. It uses a cryptic exon. [Code 'B5'] Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic exon and C-terminal FLAG
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-nsp10-nsp14 fusion (SARS-CoV-2)
Plasmid#169161PurposeTo express nsp10-nsp14 fusion protein in E. coliDepositorInsert14His-SUMO-nsp10-GGSGGS-nsp14 (ORF1ab SARS-CoV-2, Synthetic)
Tags14His-SUMO and Fusion protein of SARS-CoV-2 nsp10…ExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Anti-GFAP [N206A/8R]
Plasmid#177512PurposeMammalian Expression Plasmid of anti-GFAP (Human). Derived from hybridoma N206A/8.DepositorInsertanti-GFAP (Homo sapiens) recombinant mouse monoclonal antibody (GFAP Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#11 in pTwist-CMV backbone
Plasmid#216155PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Very bright and decent dynamic range (>10-fold), slightly leaky. It uses a single intron. [Code 'B12']. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TetON-Sox2
Plasmid#110280PurposeDoxycycline-inducible overexpression of Sox2DepositorInsertSRY (sex determining region Y)-box 2 (Sox2 Mouse)
UseLentiviralTagsNo fusion genesExpressionMammalianMutationWild typePromoterTREAvailable SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only