We narrowed to 14,052 results for: CRISPR-Cas9
-
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
Plasmid#42335PurposeA human codon-optimized SpCas9 nickase and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (empty, donor)
Plasmid#80768PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSD_SpCas9MT3-NLS-3xHA-NLS-SaCas9WT-2xNLS
Plasmid#107322PurposeExpresses SpCas9 (R1335K) fused to SaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1335K) is fused to SaCas9PromoterCMV IE93Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_SpCas9MT2-NLS-3xHA-NLS-SaCas9WT-2xNLS
Plasmid#107321PurposeExpresses SpCas9 (R1333S) fused to SaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1333S) is fused to SaCas9PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-T2A-GFP
Plasmid#53190Purpose3rd generation transfer vector. Co-expresses human optimized S. pyogenes Cas9 and GFPDepositorInserthumanized Cas9 T2A GFP
UseCRISPR and LentiviralTagsFlagExpressionMammalianPromoterhUbCAvailable SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGG>nls-hCas9-nls-GFP
Plasmid#99141PurposeCas9-GFP fusion protein under the regulation of chicken beta-actin promoterDepositorInsertCas9-GFP
UseCRISPRTagsGFPPromoterChicken beta actin (CAG)Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-VP64_Blast
Plasmid#192650Purpose3rd generation lenti vector encoding VP64-dCas9-VP64 with 2A Blast resistance markerDepositorInsertVP64-dCas9-VP64
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Eef1a-1955/-1>nls::Cas9::nls
Plasmid#59987PurposeEef1a (EF1alpha) promoter driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Eef1a (EF1alpha) -1955/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-p300_Blast
Plasmid#192654Purpose3rd generation lenti vector encoding VP64-dCas9-p300 with 2A Blast resistance markerDepositorInsertVP64-dCas9-p300
UseCRISPR and LentiviralExpressionMammalianMutationD10A; H840A in Cas9PromoterEF1aAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9+sgRNA expression vector precursor
Plasmid#171798PurposePICASSO: Library expression vector precursor for paired dCas9+sgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterpLtetOAvailable SinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mesp-1916/-1>nls::Cas9::nls
Plasmid#59988PurposeMesp driver driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Mesp -1916/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e-nCas9-V5-P2A-EGFP
Plasmid#251964PurposeExpression of ABE8e (V106W with spCas9 D10A) in mitochondria for yeast mtDNA editingDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastPromoterGPDAvailable SinceMarch 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only