We narrowed to 967 results for: plasmids spcas9
-
Plasmid#198750PurposeExpresses S. Pyogenes dCas9 fused to SmallBiT fragment of split NanoLuc luciferaseDepositorInsertSpdCas9 - SmallBiT
TagsStrep-tag IIExpressionBacterialMutationD10A, H840A (nuclease inactivating mutations in &…PromoterT7Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PEmaxdeltaRNaseH-dualU6-Dnmt1-PE3-loxP
Plasmid#207862PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Dnmt1 PE3 pegRNA and ngRNADepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Dnmt1-PE3-loxP
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-Hypa
Plasmid#218165PurposeThis plasmid harbors the base editor eSCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in StreptomycesDepositorInsertsescbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PEmaxdeltaRNaseH-dualU6-Rosa26-twinPE-attB
Plasmid#207859PurposeAAV genome encoding C-terminal PEmaxDRNaseH and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PEmaxDRNaseH-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A)-P2A-EGFP (pJUL1085)
Plasmid#123614PurposeCAG promoter expression plasmid for rAPOBEC1(R33A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A).DepositorInsertBE3(R33A)-P2A-EGFP
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-HF1
Plasmid#218164PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
BE3(E63Q)-P2A-EGFP (pRZ189)
Plasmid#123613PurposeCAG promoter expression plasmid for rAPOBEC1(E63Q)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (catalytically impaired BE3 mutant).DepositorInsertBE3(E63Q)-P2A-EGFP
ExpressionMammalianMutationE63Q in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1
Plasmid#218160PurposeThis plasmid harbors the base editor SCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-Hypa
Plasmid#218161PurposeThis plasmid harbors the base editor SCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only