We narrowed to 4,490 results for: Gca
-
Plasmid#136138PurposePlasmid to accept gRNA target with SapI, lacZ blue-white screening. Contains Cas9 and HygR.DepositorInsertp5-35Sx2:HygR p5-MpU6:lacZgRNA p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-SDHB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-B
Plasmid#177785PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-R
Plasmid#110737PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-L
Plasmid#110736PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJMP1346
Plasmid#119274Purposeknockdown folA in K. pneumoniaeDepositorInsertsgRNA folA (K. pneumoniae)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin1 KI #3
Plasmid#139659PurposeEndogenous tagging of GluN1: N-terminal (amino acid position: A20)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shTREX1
Plasmid#127700PurposeDoxycyclin inducible shRNA knockdown of both human and mouse TREX1 geneDepositorAvailable SinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-FOXM1-shRNA-84
Plasmid#89494PurposeLentiviral vector with constitutive expression of shRNA targeting human FOXM1.DepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-DEST-MatryoshCaMP6s
Plasmid#100025PurposeMammalian expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.DepositorInsertMatryoshCaMP6s
TagsV5 Epitope TagExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Po-nCas9-BE- Ptac-sgRNA(mmoX_1)
Plasmid#195741PurposeBase editing for making a pre-stop codon in mmoX using phenol inducible systemDepositorArticleInsertDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI / Ptac-RiboJ-sgRNA(mmoX_1)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPo (phoenol-inducible promoter)Available SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCD061
Plasmid#113315PurposeW108 scRNA.b1DepositorInsertW108 scRNA.b1_MS2
UseCRISPRExpressionBacterialAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shPIK3CD.v1 puro
Plasmid#58706PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only