We narrowed to 10,500 results for: fus
-
Plasmid#217728PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRF2 (ADGRF2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-435Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG3 CTF-FLAG
Plasmid#217701PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG3 (ADGRG3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-249Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG3 CTFdeltaTA-FLAG
Plasmid#217734PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG3 (ADGRG3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-255Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CSF2RA_CRLF2
Plasmid#205798PurposeExpress mEGFP-tagged fusion protein, CSF2RA_CRLF2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-mNeonGreen-NUT
Plasmid#204693PurposeThis plasmid allows for inducible expression of full-length NUT tagged with mNeonGreen, in mammalian cells.DepositorAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tom70NTD-ABHD16Acyto-mNG
Plasmid#195159Purposemammalian expression of outer mitochondrial membrane localized ABHD16A tagged with mNeonGreenDepositorInsertTom70NTD (TOMM70 Human)
TagsABHD16A cytoplasmic domain and mNeonGreenExpressionMammalianMutationNonePromoterCMVAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF385A
Plasmid#101615PurposeDonor Vector containing ZNF385A transcription factor, part of the Human TFome CollectionDepositorInsertZNF385A (ZNF385A Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
C239-E02: attB2r-IRES-ffLuc2-eGFP-pA-attB3
Plasmid#162918PurposeGateway attB2r/attB3 entry clone for generation of polycistronic ffLuc2-eGFP reporter using an internal ribosome entry sequence (IRES)DepositorInsertfirefly luciferase/green fluorescent protein fusion with upstream IRES sequence
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tmem98-mTq2
Plasmid#124504PurposeExpresses mTurquoise2-tagged mouse TMEM98 in mammalian cells (C-terminal tag)DepositorInsertTmem98 (Tmem98 Mouse)
TagsmTurquoise2ExpressionMammalianMutationstop codon was removed to allow fusion with sGFP2…PromoterCMVAvailable SinceMay 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tmem98-mCherry
Plasmid#124505PurposeExpresses mCherry-tagged mouse TMEM98 in mammalian cells (C-terminal tag)DepositorInsertTmem98 (Tmem98 Mouse)
TagsmCherryExpressionMammalianMutationstop codon was removed to allow fusion with sGFP2…PromoterCMVAvailable SinceMay 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-His:FRB:nls:VPR
Plasmid#135987PurposeExpresses the FRB rapamycin-inducible domain fused to the VPR transcriptional activation domain in mammalian cellsDepositorInsertFRB domain fused to the VPR activation domain
TagsHisExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-Flex-rev-GFPFANACfullWT
Plasmid#126551PurposeAAV Flex reverse plasmid with the coding sequence of eGFP fused to the N-term of the FMRFamide gated Na channelDepositorInserteGFP N-terminal fused to FMRFamide gate sodium channel
UseAAVAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
hRad51(F86E)–Cas9(D10A)
Plasmid#125564PurposeExpresses the Rad51(F86E)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
hRad51(G151D)–Cas9(D10A)
Plasmid#125565PurposeExpresses the Rad51(G151D)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP250 pEF1a-TALE-SunTag
Plasmid#100939PurposeEmpty TALE vector fused to SunTagx10 driven by EF1a promoter, with 3xHA tag, no PURO geneDepositorInsertTALE insertion site, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Puro-DUS2L-PSKH1
Plasmid#69472PurposeExpresses DUS2L-PSKH1 fusion geneDepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLacIBD::SDRX (GB0673)
Plasmid#68183PurposeProvides the LacI Binding Domain fused to SRDX Transcriptional Repressor as a level 0 GoldenBraid partDepositorInsertLacI Binding Domain fused to SRDX Transcriptional Repressor
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only