We narrowed to 7,706 results for: alp
-
Plasmid#206694PurposeMammalian Expression Plasmid of anti-Slo1 K+ channel (Mouse). Derived from hybridoma L6/60-1.DepositorInsertanti-Slo1 K+ channel (Mus musculus) recombinant Mouse monoclonal antibody (Kcnma1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai3
Plasmid#196050PurposeEncodes a G alpha subunit (GNAl3) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga12
Plasmid#196061PurposeEncodes a G alpha subunit (GNA12) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga13
Plasmid#196062PurposeEncodes a G alpha subunit (GNA13) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZucchini2_SFFV-RXRA-eGFP-IRES-mCherry_PuroR
Plasmid#247929PurposeOverexpression vector for eGFP tagged RXRA or NR2B1. Monitor post-translational degradation of RXRA via EGFP:mCherry ratio. Contains puromycin-resistance selection marker.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-Fusion + CBP TAZ1(340-439)
Plasmid#173762PurposeBacterial coexpression of CBP TAZ1 and CITED2/Hif1a activation domain constructsDepositorTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-FusionL21A + CBP TAZ1(340-439)
Plasmid#173763PurposeBacterial Coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIsGB1-FusionL63A + CBP TAZ1(340-439)
Plasmid#173764PurposeBacterial coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai2
Plasmid#196049PurposeEncodes a G alpha subunit (GNAl2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga11
Plasmid#196059PurposeEncodes a G alpha subunit (GNA11) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga15
Plasmid#196060PurposeEncodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2975
Plasmid#144451PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2510
Plasmid#144032PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1499
Plasmid#29247PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle28 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1498
Plasmid#29246PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle27 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1500
Plasmid#29248PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle29 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luc-ZsGreen
Plasmid#39196DepositorInsertsFirefly Luciferase Luc2P
ZsGreen
UseLentiviralExpressionMammalianPromoterEF1-alpha and EF1-alphaAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luciferase
Plasmid#21375Purposeself-inactivating 3rd generation lentiviral plasmid for co-expression of your gene of interest and LuciferaseDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 19, 2009AvailabilityAcademic Institutions and Nonprofits only -
Gaq-LSS-SGFP2
Plasmid#112951PurposeGalphaq tagged with LSS-SGFP2DepositorInsertGalphaq
TagsLSS-SGFP2ExpressionMammalianPromoterCMVAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-C1-p85beta
Plasmid#1408DepositorAvailable SinceJune 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKI-v2
Plasmid#45066PurposeExpression of PKI (PKA inhibitor)DepositorInsertcAMP-dependent protein kinase inhibitor alpha
ExpressionMammalianPromoterRSVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T3-p85beta
Plasmid#1406DepositorAvailable SinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKImut-v2
Plasmid#45067PurposeExpression of intactive PKI (PKA inhibitor) mutantDepositorInsertcAMP-dependent protein kinase inhibitor alpha
ExpressionMammalianMutationchanged Arg 20 & 21 to GlycinesPromoterRSVAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHCA/GAL4(848).ER
Plasmid#108215PurposeYeast expression vector for fusion of Gal4 AA 1-848 to hormone binding domain of estrogen receptor aDepositorInsertGal4-ERalpha HBD
ExpressionYeastMutationERalpha HBD has G400V mutationPromoterADH0Available SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTUB:FLuc
Plasmid#114578PurposeConstitutive expression of firefly luciferase in T. gondii using the alpha tubulin promoter; floxed pyrimethamine selectable marker; UPRT locus flanking sequence to direct integrationDepositorInsertFirefly Luciferase
UseCre/Lox and LuciferasePromoteralpha tubulin T. gondiiAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIII CKBs CRISPR with guides at 1-2 and 2-3
Plasmid#238525PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha3DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLII-CRISPR for CKA4
Plasmid#238521PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha4DepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKPY115
Plasmid#72669PurposeEncodes Thr251Gly-EcPheRS Under Arabinose-Inducible (PBAD) ControlDepositorInsertThr251Gly-EcPheRS
ExpressionBacterialMutationThr251Gly in Alpha SubunitPromoterPBADAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PGK_Prkaa1
Plasmid#204356PurposeLentiviral plasmid, Expresses Prkaa1 under the control of the PGK promoterDepositorInsertAMP-activated protein kinase alpha 1 (Prkaa1 Mouse)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLII-proUBI10_CKA3-FLAG_termNOS _OLE-RED
Plasmid#238522PurposePlant expression of flag-tagged A. thaliana CK2alpha3; with OLE1-RED markerDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2/shαSMA/GFP4_Seq2/clone1
Plasmid#201402PurposeKnockdown of alpha-SMA. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertalpha-SMA
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
R777-E172 Hs.PIK3R1-nostop
Plasmid#70456PurposeGateway ORF clone of human PIK3R1 [NM_181523.2] without stop codon (for C-terminal fusions)DepositorInsertPIK3R1 (PIK3R1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR Ef1a-dCas9-BFP-KRAB
Plasmid#217304Purposelentiviral vector for dCas9-BFP-KRAB on Ef1alpha promoterDepositorInsertdCas9-tagBFP-KRAB
UseCRISPR, Lentiviral, and Synthetic BiologyPromoterEf1alphaAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
R777-E171 Hs.PIK3R1
Plasmid#70455PurposeGateway ORF clone of human PIK3R1 [NM_181523.2] with stop codon (for native or N-terminal fusions)DepositorInsertPIK3R1 (PIK3R1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT3 p38
Plasmid#12658DepositorAvailable SinceSept. 21, 2006AvailabilityAcademic Institutions and Nonprofits only -
PGKdtabpA
Plasmid#13440DepositorInsertPGKdtabpA
ExpressionMammalianAvailable SinceNov. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
R777-E163 Hs.PIK3CA
Plasmid#70447PurposeGateway ORF clone of human PIK3CA [NM_006218.2] with stop codon (for native or N-terminal fusions)DepositorInsertPIK3CA (PIK3CA Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-P85(G376R)
Plasmid#40220DepositorInsertP85(G376R) (PIK3R1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Glycine 376 to ArgininePromoterCMVAvailable SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-P85(W583del)
Plasmid#40229DepositorInsertP85(W583del) (PIK3R1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationdeleted amino acid 583PromoterCMVAvailable SinceOct. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
R777-E291 Hs.RPS6KA2
Plasmid#70575PurposeGateway ORF clone of human RPS6KA2 [NM_021135.4] with stop codon (for native or N-terminal fusions)DepositorInsertRPS6KA2 (RPS6KA2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-P85(N564K)
Plasmid#40226DepositorInsertP85(N564K) (PIK3R1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Asparagine 564 to LysinePromoterCMVAvailable SinceOct. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-P85(T576del)
Plasmid#40228DepositorInsertP85(T576del) (PIK3R1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationdeleted amino acid 576PromoterCMVAvailable SinceOct. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
R777-E292 Hs.RPS6KA2-nostop
Plasmid#70576PurposeGateway ORF clone of human RPS6KA2 [NM_021135.4] without stop codon (for C-terminal fusions)DepositorInsertRPS6KA2 (RPS6KA2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLII-proUBI10_CKA3 KD K63M,N170D-FLAG_termNOS _OLE-RED
Plasmid#238523PurposePlant expression of flag-tagged A. thaliana CK2alpha3 KD K63M,N170D; with OLE1-RED markerDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-P85(E439del)
Plasmid#40221DepositorInsertP85(E439del) (PIK3R1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationdeleted amino acid 439PromoterCMVAvailable SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-3HA
Plasmid#24165DepositorTypeEmpty backboneTags3xHAExpressionMammalianAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only