We narrowed to 27,383 results for: GFP
-
Plasmid#160468PurposeYeast integration vector for the gene replacement of S. cerevisiae KAR2 fused to msGFP2 with an ER retrieval signalDepositorInsertKAR2-msGFP2-HDEL
ExpressionYeastAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-AP1x6-MGM264
Plasmid#217417PurposeLuciferase expression vector with 6 AP-1 sites and the full length GM-CSF promoter, and a chromatin priming element. Alias: LEGO-MGM264-AP-1x6DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoterMouse -284 to +28 full length CSF2 promoterAvailable sinceAug. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
KIF3A560GFP
Plasmid#129769PurposeExpresses mouse Kinesin-2 KIF3A head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKIF3A (Kif3a Mouse)
TagsGFP and His6ExpressionBacterialMutationTruncation at 359, fused to kinesin-1 starting Al…Available sinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDH_blast_MCS_Nard_GFP_D50
Plasmid#167339PurposeExpresses GFP fused to progerin (d50) in mammalian cellsDepositorInsertProgerin (LMNA Human)
UseLentiviralTagsGFPExpressionMammalianMutation50AA deletion creating Progerin instead of mature…PromoterCMVAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1alpha-soCoChR-GFP
Plasmid#107709PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. EF1alpha promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterEF1alphaAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV-hGFAP-SOX2-IRES-GFP
Plasmid#183909PurposeExpression of human SOX2 and GFP under the human GFAP ABC1D promoterDepositorAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
prs316 CUP-GFP
Plasmid#128052PurposeYeast expression vector for N terminal GFP fusionsDepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Integrin β5-GFP
Plasmid#205090PurposeExpress GFP-tagged human integrin β5 in mammalian cellsDepositorAvailable sinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Nematode, Synthetic)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-CRY2-OCRL
Plasmid#79565Purposeexpression of GFP-tagged CRY2PHR fused to inositol 5-phosphatase domain of OCRLDepositorInsertOCRL (OCRL Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationaa 234_539PromoterCMVAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
CuGFP-ATG8(416)
Plasmid#49423PurposeExpresses ATG8 fused at the N terminus to GFP under the control of the CUP1 promoter.DepositorInsertautophagy-related 8 (ATG8 Budding Yeast)
TagsGFPExpressionBacterial and YeastPromoterCUP1Available sinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PKAcs-L10X-GFP
Plasmid#108587PurposeExpresses PKAcs-GFP fusion in mammalian cells with structured linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-roGFP1-R12
Plasmid#83311PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertroGFP1-R12
Tags6xHISExpressionBacterialMutationC48S/Q80R/S147C/Q204C/N149K/F223R/S202KPromoterT7Available sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-sfGFP
Plasmid#184226PurposeExpresses SpyTag-superfolder GFP in the bacterial cytoplasm. SpyTag enables covalent reaction with SpyCatcher.DepositorInsertSpyTag-sfGFP
TagsHis6, SpyTag, and TEV protease cleavage siteExpressionBacterialPromoterT5Available sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNIR-FbGFP
Plasmid#184675PurposeNIR-Fb to GFPDepositorInsertNIR-FbGFP
ExpressionMammalianPromoterCMVAvailable sinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcryBFP_Umyo18bGFP
Plasmid#172527PurposealphaA-crystallin promoter (cry) drives GFP expression in the lens. The 600bp unc-45b muscle-specific promoter drives expression of GFP-tagged zebrafish Myo18b.DepositorInsertmyo18b
ExpressionMammalianAvailable sinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
N1-mSin1.5-GFP
Plasmid#72909PurposeGFP-tagged mSin1 (isoform 5)DepositorInsertTarget of rapamycin complex 2 subunit MAPKAP1, isoform 5 (MAPKAP1 Human)
TagseGFPExpressionMammalianAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP.N3-SLC35A1-GFP
Plasmid#186281Purposetransient expression of C-terminal GFP tagged SLC35A1 isoform a in mammalian cellsDepositorAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by