We narrowed to 19,665 results for: IRE;
-
-
MPC11 IgG2b gene
Plasmid#127248PurposeExpresses intact IgG2b gene in mammalian cellsDepositorInsertIgG2b gene with exons and alt pAs (Ighg2b Mouse)
ExpressionMammalianAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-2
Plasmid#172739PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-2; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-2
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG5-Myr-FLAG-p110β-DM
Plasmid#55719Purposeeukaryotic expression of myristoylation tag (Myr-FLAG) p110b RBD double mutant S205D, K224ADepositorInsertp110 beta
Tagsmyristoylation tag (Myr-FLAG)ExpressionMammalianMutationS205D, K224APromoterT7Available SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDGB1a2R+pNOS_Red-F_NOSt
Plasmid#170888PurposeGoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Reverse orientationDepositorInsertRed-F
UseLuciferase and Synthetic BiologyExpressionPlantMutationp.S286Y Red mutantPromoterpNOSAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-p97-RG-mycStrep
Plasmid#31840DepositorInsertp97
TagsStrep and mycExpressionBacterial and MammalianMutationR95GPromoterCMVAvailable SinceOct. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Sema4c-ISH-2kb
Plasmid#68031PurposeContains 2kb cDNA fragment for probe synthesis for mRNA in situ hybridization, species: mouseDepositorInsertSemaphorin-4C (Sema4c Mouse)
UseMrna in situ hybridization probeAvailable SinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
Plasmid#169370PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039596Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJC1-Rap2A-3xFLAG
Plasmid#87972PurposeExpression of Rap2A in mammalian cellsDepositorAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
ERAS
Plasmid#55656Purposeexpression of mouse ERASDepositorAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGREAT4
Plasmid#170892PurposeGoldenBraid Double Transcriptional Unit - pG10-90_E-Luc_NOSt+pNOS_Red-F_NOStDepositorInsertE-Luc
UseLuciferase and Synthetic BiologyExpressionPlantMutationc.375C>T silent mutation to remove BbsI site (…PromoterpG10-90Available SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
GEM
Plasmid#55680Purposeexpression of mouse GEMDepositorAvailable SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
cmamxA1-GFP
Plasmid#107195PurposeExpresses porcine annexin A1-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A1
TagsGreen Fluorescent ProteinExpressionMammalianMutationexchanges Asp170Ala, Glu255Ala, Glu330Ala, all ty…PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
fgfprom luc
Plasmid#69446Purposebasal plasmid containing minimal fgf4 promoter used for testing enhancer activity of DNAs inserted immediately upstream of the promoter.DepositorInsertminimal fgf4 promoter
UseLuciferaseExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV-CC2
Plasmid#51221Purposeexpression of amino acid 917-1040 of chicken DCTN1 p150Glued in mammalian cellsDepositorAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_2
Plasmid#106315PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorInsertsgRNA targeting mShmt2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-GW1D1a(aa254-503)
Plasmid#21520DepositorAvailable SinceSept. 21, 2009AvailabilityAcademic Institutions and Nonprofits only