176,531 results
-
Plasmid#112096PurposeC:G-to-T:A base editingDepositorInsertBE4max_3xHA
UseCRISPRTags3xHAExpressionMammalianPromoterCMVAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FKBP-mCherry
Plasmid#108122PurposeRecruitable fluorophoreDepositorAvailable sinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EB3-mScarlet-I
Plasmid#98826PurposeIn vivo visualization of microtuble plus ends (can be used for colocalization studies)DepositorInsertEB3
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJL 89
Plasmid#98558PurposeUseful for making infectious clones of RNA virus cDNAs; Has 35S promoter and HDV Ribozyme sequences in T-DNA region of Agrobacterium vector.DepositorTypeEmpty backboneExpressionPlantPromoterEnh 35SAvailable sinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs ABCDE>A
Plasmid#83318Purposehuman DNA-PKcs/ABCDE>alaDepositorInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutation6 phosphorylation sites in the ABCDE cluster subs…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-TrxRFP1
Plasmid#98996Purposemammalian expression of a biosensor to monitor thioredoxin redox dynamicsDepositorInserthuman thioredoxin 1, GS-rich linker, fused with a redox-sensitive RFP
TagsHis-tagExpressionMammalianPromoterCMVAvailable sinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C0000
Plasmid#91081PurposeModule C, Promoter: none, Gene: none (BaeI site for GT donor cloning), Terminator: noneDepositorTypeEmpty backboneUseUnspecifiedAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7TFP CDH1 reporter
Plasmid#91704Purposelentiviral luciferase reporter containing CDH1 promoterDepositorInsertCDH1 promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianPromoterCDH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_HSP90B1_WT
Plasmid#82130PurposeGateway Donor vector containing HSP90B1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-HaloTag-KanMX6
Plasmid#87029PurposeTag S. pombe genes in C terminal with HaloTagDepositorInsertHaloTag
ExpressionBacterial and YeastAvailable sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available sinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY095
Plasmid#84744PurposeExpresses huLbCpf1-T2A-GFP and crRNA guideDepositorInsertshuLbCpf1
GFP
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pP{ELAV-GeneSwitch}
Plasmid#83957PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotorDepositorInsertExpressionInsectPromoterelavAvailable sinceDec. 10, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-loxP-mTagBFP2-stop-pA-loxP
Plasmid#75158PurposeFloxed TagBFP2 (blue) fluorophore with stop codon for inducible lines.DepositorPublicationInsertloxP-mTagBFP2-stop-pA-loxP
UseMiddle entry vector for multisite gateway three f…Promotern/aAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_Zika_NS4B_Flag
Plasmid#79640PurposeThird generation Self-inactivating lentivector expressing NS4B from Zika virusDepositorInsertNS4B
UseLentiviralTagsFlagExpressionMammalianPromoterEF1Available sinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-smURFP-T2A-mCardinal
Plasmid#80348PurposeLentiviral transfer vector under the CMV promoter that expresses smURFP and mCardinal.DepositorInsertssmURFP
mCardinal
UseLentiviralPromoterCMVAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPICZalphaB-SapL3
Plasmid#78171PurposeExpression of Saporin L3 in pichiaDepositorInsertSaporin L3
Tagsalpha factorExpressionYeastAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLC-217
Plasmid#73163PurposeTemplate plasmid which encodes a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) to be used as a negative selection marker.DepositorAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only