-
Plasmid#114427PurposeTarget a Cre-dependent GFP and a tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterPGK, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin-SV40 T antigen-IRES-mCherry
Plasmid#58993Purposelentiviral expression of SV40 large T antigen and mCherry red fluorescent reporterDepositorInsertsCMV enhancer-chicken beta actin promoter
SV40 large T antigen
IRES-mCherry red fluorescent protein
UseLentiviralTagsExpressionMammalianMutationEcoRV site in MCS converted to BamHI sitePromoterCMV enhancer-chicken beta actinAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cilantro 2
Plasmid#74450PurposeCan clone in a C2H2 zinc finger via BsmBI restriction sites and monitor post-translational degradation using EGFP:mCherry ratio (Lentiviral, PGK.BsmBICloneSite-EGFP.IRES.mCherry.cppt.EF1a.PuroR)DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch1#1/Cre
Plasmid#193223PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch1 geneDepositorInsertsgNotch1#1 (Notch1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorInsertsgNotch2#2 (Notch2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorInsertsgNkx2-1#1 (Nkx2-1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorInsertsgNotch2#1 (Notch2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorInsertsgRunx1t1#2 (Runx1t1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#1/Cre
Plasmid#193242PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorInsertsgTmem132d#1 (Tmem132d Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorInsertsgTmem132d#2 (Tmem132d Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#1/Cre
Plasmid#193248PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorInsertsgZfp536#1 (Zfp536 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#1/Cre
Plasmid#193239PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorInsertsgSpen#1 (Spen Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPrdm9#1/Cre
Plasmid#193231PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Prdm9 geneDepositorInsertsgPrdm9#1 (Prdm9 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#1/Cre
Plasmid#193229PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorInsertsgPcdh15#1 (Pcdh15 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPrdm9#2/Cre
Plasmid#193232PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Prdm9 geneDepositorInsertsgPrdm9#2 (Prdm9 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#2/Cre
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorInsertsgSpen#2 (Spen Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorInsertsgTnr#2 (Tnr Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSphkap#2/Cre
Plasmid#193241PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sphkap geneDepositorInsertsgSphkap#2 (Sphkap Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#2/Cre
Plasmid#193238PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorInsertsgSis#2 (Sis Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#1/Cre
Plasmid#193237PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorInsertsgSis#1 (Sis Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#2/Cre
Plasmid#193247PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorInsertsgTsc1#2 (Tsc1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorInsertsgTnr#1 (Tnr Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#2/Cre
Plasmid#193228PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorInsertsgNotch3#2 (Notch3 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#2/Cre
Plasmid#193230PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorInsertsgPcdh15#2 (Pcdh15 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#1/Cre
Plasmid#193246PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorInsertsgTsc1#1 (Tsc1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#2/Cre
Plasmid#193249PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorInsertsgZfp536#2 (Zfp536 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRos1#1/Cre
Plasmid#193233PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 geneDepositorInsertsgRos1#1 (Ros1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRos1#2/Cre
Plasmid#193234PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 geneDepositorInsertsgRos1#2 (Ros1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#1/Cre
Plasmid#193235PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorInsertsgRunx1t1#1 (Runx1t1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch1#2/Cre
Plasmid#193224PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch1 geneDepositorInsertsgNotch1#2 (Notch1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#2/Cre
Plasmid#193222PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorInsertsgNkx2-1#2 (Nkx2-1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#1/Cre
Plasmid#193227PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorInsertsgNotch3#1 (Notch3 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Bidirectional MYC 5'UTR Dual Fluorescence Reporter
Plasmid#229498PurposeThis is a lentiviral reporter for translation initiation under the control of the Myc 5'UTR, which produces destabilized GFP (dsGFP). There is a control destabilized mCherry (dsmCherry) as a control.DepositorInsertMYC 5'Untranslated region + destabilized GFP
UseLentiviralTagsExpressionMammalianMutationPromoterEf1aAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
shCD44-2 pRRL
Plasmid#19123DepositorInsertsmall hairpin RNA against CD44 (CD44 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceOct. 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-34: TNNI1-mEGFP
Plasmid#114411PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TNNI1, via excisable Cas9-excisable hPGK-mCherry selection cassetteDepositorInsertTNNI1 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (TNNI1 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRL_GI_PCB28
Plasmid#98745PurposeFor phycocyanobilin production in Saccharomyces cerevisiae. Contains integrative cassette for the yeast his1-Δ200 locus. Encodes constitutively expressed HY1 and PcyA.DepositorInsertsUseSynthetic BiologyTagsExpressionYeastMutationCodon optimized for Saccharomyces cerevisiaePromoterADH1m and PGK1Available sinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS2194-RP_PiggyBac_SpCas9ABE8e-tracrRNA-Puro
Plasmid#211821PurposePiggyBac vector expressing SpCas9-ABE8e with tracrRNA for stable cell line establishmentDepositorInsertSpCas9-ABE8e, tracrRNA and Puromycin resistance gene
UseTagsExpressionMammalianMutationPromoterchicken β-actin promoter, U6 promoter and hPGK pr…Available sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralTagsExpressionMammalianMutationPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#2/Cre
Plasmid#193220PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorInsertsgMroh2b#2 (Heatr7b2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#1/Cre
Plasmid#193219PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorInsertsgMroh2b#1 (Heatr7b2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorInsertsgCrebbp#2 (Crebbp Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgHcn1#2/Cre
Plasmid#193218PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Hcn1 geneDepositorInsertsgHcn1#2 (Hcn1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#2/Cre
Plasmid#193204PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorInsertsgBrip1#2 (Brip1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFam135b#2/Cre
Plasmid#193214PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Fam135b geneDepositorInsertsgFam135b#1 (Fam135b Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only