We narrowed to 10,009 results for: Gnas
-
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_pBabePuro
Plasmid#58422Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids P29 to D408Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV GFAP CaBLAM
Plasmid#244228PurposeBioluminescent reporter for calcium signaling in astrocytesDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FLEX-rc[Chronos-GFP]
Plasmid#62725PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1αAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3mts
Plasmid#195577PurposeExpresses STAT3 with mitochondrial targeting sequenceDepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVTagsCox8 presequenceExpressionMammalianPromoterCMV enhancer and promoterAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Mito-Car-GECO
Plasmid#100765PurposeLentiviral tet-inducible expression of mito-targeted genetically encoded Ca2+-indicators for optical imagingDepositorInsertLenti-Mito-Car-GECO
UseLentiviralTagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationR-GECO1: E163V/I166V/V174T/M176I/F222I/A302PPromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
rag2:myr-Akt2_pISceI
Plasmid#231495PurposeExpresses myristolated Akt2 in zebrafish lymphoid and mesenchymal cellsDepositorAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His Y95F/Y188F/Y426F/Y517F hTFNG hTFNG
Plasmid#70085PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to bind iron in either the N-lobe or the C-lobeN-lobeDepositorInsertmutated human serum transferrin (TF Human)
TagsHexa His tag and N-terminal signal peptide, 4 aa …ExpressionMammalianMutationAsn413 Asp, Asn611Asp, Tyr95Phe, Tyr188Phe, Ty426…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV hPGRN
Plasmid#213682PurposeExpresses human progranulin (PGRN) with an N-terminal twin-Strep-V5 tagDepositorInsertHuman Progranulin (hPGRN) (GRN Human)
UseAAVTagsTwin-Strep tag and V5 tag (after signal peptide)Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-ALFA-His
Plasmid#171568PurposeBacterial expression of ALFA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-ALFA-His)DepositorInsertNb127D01-ALFA-His (CXCR2 Human)
TagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mTet2 catalytic domain HxD
Plasmid#79611PurposeExpression of catalytically inactive mouse Tet2DepositorInsertTet2 (Tet2 Mouse)
UseLentiviralTagsMycMutationMutant Tet2 with H1302Y, D1304A substitutions in …Available SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2K7bsdUBI-mCherry-STIM1
Plasmid#114178PurposeLentiviral vector for expression of mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseLentiviralTagsmCherry (inserted after signal peptide)ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
LPAR1-DuET
Plasmid#213329PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only