169,512 results
-
Plasmid#40260PurposeRFP with robust performance in protein fusions and useful as FRET acceptor for Clover in a FRET pair that offers bright fluorescence, dynamic range, and photostability while limiting emissions overlapDepositorHas ServiceCloning Grade DNAInsertmRuby2
TagsHis6 and XpressExpressionMammalianPromoterCMV IEAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_zeo backbone
Plasmid#61427Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-iCre
Plasmid#89573PurposeExpresses iCre under pCAGDepositorInsertiCre
UseCre/Lox and Synthetic BiologyTagsNLSExpressionMammalianAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-hNINJ1-GFP
Plasmid#208779PurposeInducibly expresses human NINJ1 tagged with GFPDepositorAvailable SinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/HIS/FLAG/HA-ALKBH5
Plasmid#38073DepositorInsertALKBH5 alkB, alkylation repair homolog 5 (E. coli) (ALKBH5 Human)
TagsHIS/FLAG/HAExpressionMammalianMutationcDNA clone MGC:71143 IMAGE:6339184 with longer 3&…Available SinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
ADORA3-Tango
Plasmid#66212PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pProEx-HTa-SOD1 WT
Plasmid#191849Purposeexpress wild-type SOD1 in bacterial cellsDepositorInsertSOD1 (SOD1 Human)
ExpressionBacterialAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LVDP-CArG-RE-GPR
Plasmid#89762PurposeQuantitative measurement of CArG response element activity.DepositorInsert6X CArG-RE
UseLentiviralTagsCMV-ZsGreenExpressionMammalianAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only