We narrowed to 3,314 results for: GCT
-
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUbC-EGFP-sgRNA.FOXA1/A2/A3_CRISPRi
Plasmid#216166PurposeExpress the gRNAs for the human FOXA1/A2/A3-CRISPRiDepositorInsertUseLentiviralTagsEGFPExpressionMutationPromoterphU6, ph7SK, phH1, pmU6Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode6
Plasmid#229068PurposeExpression mappingDepositorInsertCAG Barcode6
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode16
Plasmid#226195PurposeExpression mappingDepositorInsertSyn Barcode16
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode18
Plasmid#226191PurposeExpression mappingDepositorInsertSyn Barcode18
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralTagsExpressionMutationPromoterbU6/mU6/hU6Available sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHK352.3
Plasmid#235473PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone RSF1030)DepositorArticleInsertsgRNA3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWT055h
Plasmid#96867PurposesgRNA-HEK4DepositorInsertsgRNA-HEK4
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHK052.3
Plasmid#235472PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone RSF1030)DepositorArticleInsertsgRNA3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorArticleInsertsgRNA1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.3
Plasmid#235462PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone pBR322)DepositorArticleInsertsgRNA3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.5
Plasmid#235464PurposeMessage phagemid carrying sgRNA5 (prom. J23119, backbone pBR322)DepositorArticleInsertsgRNA5
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.1
Plasmid#235466PurposeMessage phagemid carrying sgRNA1 (prom. J23110, backbone pBR322)DepositorArticleInsertsgRNA1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.3
Plasmid#235468PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone pBR322)DepositorArticleInsertsgRNA3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.5
Plasmid#235470PurposeMessage phagemid carrying sgRNA5 (prom. J23110, backbone pBR322)DepositorArticleInsertsgRNA5
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF1
Plasmid#117156PurposeTarget site TTGCTCTTAGCATCTCGGCTGDepositorInsertshRNA targeting miR30
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM sh2 DNMT1
Plasmid#88885PurposeLentiviral vector expressing shRNA against murine DNMT1DepositorInsertshRNA no.2 DNMT1
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV (spleen focus forming virus)Available sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM sh1 DNMT1
Plasmid#88884PurposeLentiviral vector expressing shRNA against murine DNMT1DepositorInsertshRNA no.1 DNMT1
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV (spleen focus forming virus)Available sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only