We narrowed to 13,645 results for: sequence
-
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221_SLC39A14
Plasmid#132105PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC39A14 (SLC39A14 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMT-flk1-cytoBirA-2A-mCherry_Ras
Plasmid#80056PurposeFlk1/Kdrl promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterflk1Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SYFP2-CTNNB1
Plasmid#153432PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SYFP2DepositorInsertCTNNB1 homology arms and SYFP2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSYFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC7A3
Plasmid#132301PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC7A3 (SLC7A3 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-NLS-BirA-2a-mCherry
Plasmid#79886PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-MCS-NLS-BirA-2A-mCherry_Ras
Plasmid#80059PurposeMCS for cloning promoter to drive HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Pyr pUAST-HA
Plasmid#69768PurposePyramus (FGF8-like-2) Ligand in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPyramus (FGF8like-2) (pyr Fly)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutation241T amino acid insertion compared to reference s…Promoterhsp70 promoterAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flrt1-AP-His
Plasmid#71947PurposeExpresses the extracellular region of the FLRT1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-CCR5-VN
Plasmid#98963PurposeFLAG-tagged human CCR5 fused to N-terminus of split VenusDepositorInsertCCR5 (CCR5 Human)
TagsFLAG (dykdddd) epitope tag, Signal/leader sequenc…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mqgDUX4mqg*
Plasmid#21177DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 6163 (numbering acco…Available SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-Venus-cpVenus-FLARE-AKAR
Plasmid#123337PurposePlasma membrane-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertLyn-Venus-cpVenus-FLARE-AKAR
TagsN-terminal targeting sequence from Lyn kinase, Ve…ExpressionMammalianPromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-Avi-Cerulean-RanGAP
Plasmid#79881PurposeUbiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1) (RANGAP1 Chicken)
TagsAviExpressionBacterialPromoterUbiquitin promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZIKV_NASBA_32B
Plasmid#75011PurposePortion of Zika Virus genome (KU312312: 7066-7399) containing sensor 32B trigger sequence and NASBA amplification sitesDepositorInsertZIKV_NASBA_32B
ExpressionBacterialPromoterT7Available SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only